warning in 6edf172f7a86963f: in extension for PomBase-genotype-1628, can't find feature with identifier: exo2 - too many matches for exo2 warning in 63f563e7fdecebe3: description for new allele "nc-pho1-5'splice-doner(1772-1774)" does not match the existing allele with the same name "nc-pho1-5'splice-doner(1723-1726)" (from session 63f563e7fdecebe3) warning in 63f563e7fdecebe3: storing feature_cvterm from 63f563e7fdecebe3-genotype-13 (nc-pho1-5'splice-doner) to increased gene expression [assayed_using] PomBase:SPBP4G3.02 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties: evidence: "transcript expression level evidence" from session: 63f563e7fdecebe3 warning in 8589306346786b20: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 5bef3e6a63b5bcf4) warning in 1c51e41628bda782: occurs_at() not allowed for cellular_component, annotation: SPBC216.07c.1 <-> nucleolar chromatin warning in 1c51e41628bda782: occurs_at() not allowed for cellular_component, annotation: SPBC216.07c.1 <-> nucleolar chromatin warning in 1c51e41628bda782: occurs_at() not allowed for cellular_component, annotation: SPAC57A7.11.1 <-> nucleolar chromatin warning in 1c51e41628bda782: occurs_at() not allowed for cellular_component, annotation: SPAC57A7.11.1 <-> nucleolar chromatin genotype DUMMY has no alleles warning in ff1e67fe7824549f: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" (from session 66d1d84a63cd8a3e) warning in 6e7137c59c7c4231: description for new allele "clr4+(clr4delta->clr4+)" does not match the existing allele with the same name "clr4+(wild type)" (from session f08c0f4e1a2f2ba5) warning in 6e7137c59c7c4231: allele_type for new allele "clr4+(other)" does not match the existing allele with the same name "clr4+(wild_type)" (from session f08c0f4e1a2f2ba5) warning in 6e7137c59c7c4231: description for new allele "clr4+(clr4delta->clr4+)" does not match the existing allele with the same name "clr4+(wild type)" (from session f08c0f4e1a2f2ba5) warning in 6e7137c59c7c4231: allele_type for new allele "clr4+(other)" does not match the existing allele with the same name "clr4+(wild_type)" (from session f08c0f4e1a2f2ba5) warning in ef8c7a4f76471904: description for new allele "swi6-CD(1-80,140-328)" does not match the existing allele with the same name "swi6-CD(1-2)" (from session 6e7137c59c7c4231) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session 66d1d84a63cd8a3e) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-T4A(rpb1-CTD-T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S2A(rpb1-CTD-S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 66d1d84a63cd8a3e) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(rpb1-CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A)" (from session 4228fd893e7a1a88) warning in 24a3853610543a99: description for new allele "prp10-1(A1050V,S1058F)" does not match the existing allele with the same name "prp10-1(A1089V,S1097F)" (from session e8547aef6b97c8ef) warning in 1088ee3f2681b5d2: description for new allele "prp10-1(A1050V,S1058F)" does not match the existing allele with the same name "prp10-1(A1089V,S1097F)" (from session e8547aef6b97c8ef) warning in 4847e0de3cb01075: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 5bef3e6a63b5bcf4) warning in 7d409d497eb075ca: description for new allele "prp10-1(A1050V,S1058F)" does not match the existing allele with the same name "prp10-1(A1089V,S1097F)" (from session e8547aef6b97c8ef) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in 5f8aff66a56b4439: badly formatted transcript_isoform_id ID: "PR:000064868" warning in acd89b47e1b47f21: description for new allele "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" does not match the existing allele with the same name "spt5-CTD-T1A(CTD-T1A)" (from session 8481a1a5bf90b23e)