warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-T4A(rpb1-CTD-T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session fcfd9a50a6a6cb53) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S2A(rpb1-CTD-S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 33497d588756c658) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(rpb1-CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A)" (from session fcfd9a50a6a6cb53) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in 0a152fcef2281eac: can't load annotation, GO:1903253 is an obsolete term warning in 0a152fcef2281eac: can't load annotation, GO:1903255 is an obsolete term warning in 0a152fcef2281eac: can't load annotation, GO:0044876 is an obsolete term warning in 6e7137c59c7c4231: description for new allele "clr4+(clr4delta->clr4+)" does not match the existing allele with the same name "clr4+(wild type)" (from session d77be516bab87443) warning in 6e7137c59c7c4231: allele_type for new allele "clr4+(other)" does not match the existing allele with the same name "clr4+(wild_type)" (from session d77be516bab87443) warning in 6e7137c59c7c4231: description for new allele "clr4+(clr4delta->clr4+)" does not match the existing allele with the same name "clr4+(wild type)" (from session d77be516bab87443) warning in 6e7137c59c7c4231: allele_type for new allele "clr4+(other)" does not match the existing allele with the same name "clr4+(wild_type)" (from session d77be516bab87443) warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in af39cc71da933c2d: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in acd89b47e1b47f21: description for new allele "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" does not match the existing allele with the same name "spt5-CTD-T1A(CTD-T1A)" (from session 8481a1a5bf90b23e) warning in ff1e67fe7824549f: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in ff1e67fe7824549f: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" (from session 67f8ea3e5c1c1bfc) warning in 66d1d84a63cd8a3e: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) genotype DUMMY has no alleles