warning in c6ced0325cbf00af: storing feature_cvterm from c6ced0325cbf00af-genotype-2 to increased protein localization to chromatin [assayed_using] PomBase:SPBC1105.17 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Microscopy", condition: "FYECO:0000004"  from session: c6ced0325cbf00af
warning in c6ced0325cbf00af: storing feature_cvterm from c6ced0325cbf00af-genotype-2 to increased protein localization to chromatin [assayed_using] PomBase:SPBC1105.17 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000004", evidence: "Microscopy"  from session: c6ced0325cbf00af
warning in c6ced0325cbf00af: storing feature_cvterm from c6ced0325cbf00af-genotype-2 to increased protein localization to centromere outer repeat [assayed_using] PomBase:SPBC1105.17 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Chromatin immunoprecipitation experiment"  from session: c6ced0325cbf00af
warning in c6ced0325cbf00af: storing feature_cvterm from c6ced0325cbf00af-genotype-2 to increased protein localization to centromere outer repeat [assayed_using] PomBase:SPBC1861.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Chromatin immunoprecipitation experiment"  from session: c6ced0325cbf00af
warning in c6ced0325cbf00af: storing feature_cvterm from c6ced0325cbf00af-genotype-2 to increased protein localization to subtelomeric heterochromatin during vegetative growth [assayed_using] PomBase:SPBC1105.17 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Chromatin immunoprecipitation experiment"  from session: c6ced0325cbf00af
warning in 4ac0ce427dd07a35: description for new allele "Growth defect suppression(Growth defect is suppressed by overexpression of SPBC1E8.05)" does not match the existing allele with the same name "Growth defect suppression(Growth defect is suppressed by overexpression of SPCC1322.10)" (from session 4ac0ce427dd07a35)
warning in 8de8896718b55bd8: storing feature_cvterm from PomBase-genotype-582 to normal protein localization to site of mechanical stress [assayed_protein] PomBase:SPBC30B4.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Microscopy"  from session: 8de8896718b55bd8
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-Y1F((CTD)Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F((CTD)-Y1F)" (from session 67f8ea3e5c1c1bfc)
warning in 2a8be2bb0239204b: description for new allele "plo1-TEVAA341(tev-site@AA341)" does not match the existing allele with the same name "plo1-TEVAA341(TEVAA341)" (from session 2a8be2bb0239204b)
warning in 2a8be2bb0239204b: description for new allele "plo1 fusion (Cnp3)(Plo1 centromere tethered)" does not match the existing allele with the same name "plo1 fusion (Cnp3)(Plo1-centromere tethered)" (from session 2a8be2bb0239204b)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTD-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 6186ba197a53e798)
warning in 8481a1a5bf90b23e: description for new allele "spt5(T1E)7(CTD-T1E)" does not match the existing allele with the same name "spt5(T1E)7(T1E mutations within the CTR)" (from session 8481a1a5bf90b23e)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTR-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 8481a1a5bf90b23e)
warning in 216f4dec12ef6153: description for new allele "ndc80-GFP(GFP-C)" does not match the existing allele with the same name "ndc80-GFP(ndc80 tagged with GFP)" (from session fe7a0f32d4e76d5d)
warning in e976a54955ad43a4: description for new allele "cdc27-R39(827-TCGACAATCGATAAGACTGACA)" does not match the existing allele with the same name "cdc27-R39(nt 807-828 duplicated; translated product has aa 1-179 plus 4 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R39(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R39(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R22(782-C)" does not match the existing allele with the same name "cdc27-R22(nt C inserted after 782; translated product has aa 1-164 plus 12 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R22(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R22(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(nt 930-1102 duplicated; translated product has aa 1-271 plus 24 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R5(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R5(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R40(nt 968-1025 duplicated; translated product has aa 1-245 plus 5 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R40(1025-TTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAG)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R40(other)" does not match the existing allele with the same name "cdc27-R40(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R3(nt 813-828 duplicated; translated product has aa 1-179 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R3(827-ATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R3(other)" does not match the existing allele with the same name "cdc27-R3(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R25(nt 694-814 duplicated; translated product has aa 1-175 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R25(814-GTTGTTTGACATTCGATCCTTCCGTCTTCGGAAGACTAACTTATTGTAGCCTCGTGTTTTGAAAAAGGCACCTTCAACTCATTCCCCCCAATTATCTGTTCCCTCAAAGACATCGACAATC)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R25(other)" does not match the existing allele with the same name "cdc27-R25(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in 37237b530ab38bc9: description for new allele "cdc23-tstd(degron(DHFR),C239Y)" does not match the existing allele with the same name "cdc23-tstd(fusion;C239Y,AA424::TEV,degron)" (from session 4488533ca5f8fdc3)
warning in 37237b530ab38bc9: description for new allele "mcm4-tstd(cdc21-M68-degron(DHFR))" does not match the existing allele with the same name "mcm4-tstd(N-terminus of Mcm4/cdc21-M68 fused to DHFR degron)" (from session 56ce08f89dc9d46c)
genotype DUMMY has no alleles
warning in 88d2e1acdc9993bc: description for new allele "ral3-cor-C-GFP fusion(Scd2 localized to both cell ends)" does not match the existing allele with the same name "ral3-cor-C-GFP fusion(ral3-cor-C-GFP fusion)" (from session 88d2e1acdc9993bc)
warning in 7d2c05ef7277f909: description for new allele "cnp3C-TEV(protease inactivated)" does not match the existing allele with the same name "cnp3C-TEV(cnp3C-TEV)" (from session 2a8be2bb0239204b)
warning in db9b5a7b5f36c25c: description for new allele "rec8(TEV)(rec8-AA341::TEV)" does not match the existing allele with the same name "rec8(TEV)(rec8-AA362::TEV)" (from session db9b5a7b5f36c25c)
warning in f7e61f1bbab2a27b: description for new allele "myo2-ST(chimera+myp2-aa1923-2104)" does not match the existing allele with the same name "myo2-ST(+myp2-aa1923-2104)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: allele_type for new allele "myo2-ST(other)" does not match the existing allele with the same name "myo2-ST(amino_acid_insertion)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: description for new allele "myo2-LT(chimera + myp2-aa1622-2104)" does not match the existing allele with the same name "myo2-LT(+ myp2-aa1622-2104)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: allele_type for new allele "myo2-LT(other)" does not match the existing allele with the same name "myo2-LT(amino_acid_insertion)" (from session f7e61f1bbab2a27b)
warning in 82c72ac61a6cf9b2: allele_type for new allele "cdc1-E2(other)" does not match the existing allele with the same name "cdc1-E2(amino_acid_insertion_and_deletion)" (from session 82c72ac61a6cf9b2)
warning in 1f46f7473f4ec0a4: can't load annotation, GO:0030173 is an obsolete term