Changes between Version 530 and Version 531 of AntoniasCuratedPapers


Ignore:
Timestamp:
Jul 20, 2012, 11:51:03 AM (9 years ago)
Author:
antonialock
Comment:

--

Legend:

Unmodified
Added
Removed
Modified
  • AntoniasCuratedPapers

    v530 v531  
    131131[[BR]]
    132132||7975894||Antonia||
    133 ||gpa1||increased protein level during nitrogen starvation||allele=Q244L, assayed_using(PomBase:SPMTR.02), reporter gene assay||
    134 ||ras1||increased protein level during cellular response to pheromone||allele=G17V, assayed_using(PomBase:SPMTR.02), reporter gene assay||
    135 ||mat1Pm/pi||promoter element mapped in paper -61- -41 (ccctctttctttgttccttat||||
     133||byr1||decreased protein level during nitrogen starvation||allele=sterile-byr1, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     134||ste2||decreased protein level during nitrogen starvation||allele=sterile-ste2, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     135||ste4||decreased protein level during nitrogen starvation||allele=sterile-ste4, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     136||ras1||decreased protein level during nitrogen starvation||allele=sterile-ras1, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     137||ste6||decreased protein level during nitrogen starvation||allele=sterile-ste6, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     138||ste7||decreased protein level during nitrogen starvation||allele=sterile-ste7, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     139||byr2||decreased protein level during nitrogen starvation||allele=sterile-byr2, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     140||ste9||decreased protein level during nitrogen starvation||allele=sterile-ste9, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     141||gpa1||decreased protein level during nitrogen starvation||allele=sterile-gpa1, assayed_using(PomBase:SPMTR.02), reporter gene assay||
     142||spk1||decreased protein level during nitrogen starvation||allele=sterile-spk1, assayed_using(PomBase:SPMTR.02), reporter gene assay||
    136143
    137144[[BR]]
     
    152159||cig2/fkh2/mei4||reduced zygote formation||allele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)||
    153160||cig2/fkh2/fhl1/mei4||reduced zygote formation||allele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)||
    154 
    155 [[BR]]
    156 ||15659165||Antonia||
    157 ||mam2||GO:1901099 Label: negative regulation of signal transduction in absence of ligand||IMP||
    158161
    159162[[BR]]
     
    378381[[BR]]
    379382||7565608||http://oliver0.sysbiol.cam.ac.uk/pombe/curs/07cc7abfbaa6d1b0||
    380 ||ade genes||for FYPO:0000825 annotation add 'during cellular response to adenine starvation' term req||don't add for cyr1||
    381383||rds1|| /controlled_curation="term=gene expression, mRNA level; annotation_extension=during(cellular response to adenine starvation); qualifier=increased; evidence=ECO:0000106; db_xref=7565608; date=20120504"
    382384
     
    470472[[BR]]
    471473||9813085||http://curation.pombase.org/pombe/curs/b91556d0478e3dea||
    472 ||alg6||decreased glc1man9GlcNAc level||DNJ added, chromatography, deletion||
    473 ||alg6||absent glc2man9GlcNAc||DNJ added, chromatography, deletion||
    474 ||alg6||absent glc3man9GlcNAc||DNJ added, chromatography, deletion||
    475 ||alg6||increased man9GlcNAc||DNJ added, chromatography, deletion||
    476 ||alg6||increased man8GlcNAc||DNJ added, chromatography, deletion||
    477 ||alg6||decreased glc1man9GlcNAc level||chromatography, deletion||
    478 
    479474||alg6|gpt1||decreased glc1man9GlcNAc level||DNJ added, chromatography, deletion of both||
    480475||alg6|gpt1||increased man9GlcNAc level||DNJ addedchromatography, deletion of both||
     
    537532
    538533[[BR]]
    539 ||18621924||http://curation.pombase.org/pombe/curs/3771247b8002271||
    540 ||cgs1||change FYPO to nuclear export in response to salt starvation abolished ||microscopy, allele=cgs1delta(deletion),​annotation_extension=assayed_using(GeneDB_Spombe:SPBC106.10)||
    541 
    542 [[BR]]
    543534||7898433||http://curation.pombase.org/pombe/curs/5964257cca6cfa69||
    544535||uvi15||gene expression, change in response to L-canavanine to during the above once the term is in||artemis||
    545 
    546 [[BR]]
    547 ||11693916||http://curation.pombase.org/pombe/curs/126fe1061f88a098||
    548 ||gms1||negative regulation of co-flocculation via cell wall pilus-carbohydrate interaction||IMP||
    549 ||var phenotypes||see SF item https://sourceforge.net/tracker/?func=detail&aid=3542058&group_id=65526&atid=2096431||||
    550 
    551 [[BR]]
    552 ||11472912||http://curation.pombase.org/pombe/curs/4848741850c276d2||
    553 ||gms1||negative regulation of co-flocculation via cell wall pilus-carbohydrate interaction||IMP||
    554536
    555537[[BR]]
     
    594576||nro1||+ve reg of cellular response to hypoxia||IDA||
    595577
    596 [[BR]]
    597 ||9135147||http://curation.pombase.org/pombe/curs/67ba83cbaba024a7||
    598 ||var||change phenotype 'during' extensions to precomposed||||
    599578
    600579[[BR]]