
Version 495 (modified by antonialock, 9 years ago) (diff)


Papers needing ODA conversions
Papers with WT info or no annotations

dmr1 (ppr3)mitochondrial translation phenotype, less translation of mt proteinsallele=deletion
variousadd missing phenotype alleles

lkh1, dsk1((phenotype)) slow cell growth (cell growth assay)allele=Δdsk1Δlkh1
lkh1, dsk1((phenotype)) slow cell growth (cell growth assay)allele=Δdsk1,lkh1-K391A

rtt109Delta rtt109/Histone H3 K56R double-mutant phenotypeasynthetic sensitivity to DNA damage

mat2-P...or mat2-Pc/Pi?Silenced (waiting for GeneDB to update cassette info so this can be annotated)IMP mat1-
mat3-M...or mat3-Mc/Mi?Silenced (waiting for GeneDB to update cassette info so this can be annotated)IMP mat1-
mat1-MiPhenotype: can conjugate but not undergo meiosis/sporulateallele=Mifs15(del_nt43-129)
mat1-PiPhenotype: can conjugate but not undergo meiosis/sporulateallele=Piop7(del_nt19-357)
mat1-PcPhenotype: can't conjugateallele=Pcop5(del_nt17-480)
mat1-McPhenotype: can't conjugateallele=Mcop7(del_nt19-546)
mat1-Pcsevere reduction in spore formationallele=deletion
mat1-Pcprocess: required for efficient meiosisIMP, allele=deletion
mat1-Mcprocess: required for efficient meiosisIMP, allele=deletion
mat1-Pcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Pcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Mcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Mcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Piexpression: not expressed (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Piexpression: not expressed (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Miexpression: not expressed (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Miexpression: not expressed (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
All 4 are upregulated in response to nitrogen starvation. In diploid; downregulation at 6h compared to 4h, in haploid; no downregulation

map1transcription phenotype, target is not upregulated in response to nitrogen starvationallele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-PC,(strain is H90))
mat1-Pcpositive autoregulation of transcription in response to nitrogen starvationallele=mat1-Pc-161()
map1transcription phenotype, target is not expressed in response to nitrogen starvationallele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm,(strain is H90))
mat1-Pctranscription phenotype, target is not expressed in response to nitrogen starvationallele=mat1-Pc-161(),annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm,(strain is H90))
mat1-Pclow constitutive expression in rich mediaallele=H90(fus1 deletion)
mat1-Pmno constitutive expression in rich mediaallele=H90(fus1 deletion)
mat1-Pmexpression in response to nitrogen starvation is dependent on the presence of CL:0002674annotation_extension=occurs_in(CL:0002675)
mat1-Pcupregulation in response to nitrogen starvation is not dependent on the presence of CL:0002674annotation_extension=occurs_in(CL:0002675)
ran1process: negative regulation of transcription from RNA polymerase II promoter during mitosis (IMP evidence code)allele=pat1-114,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm, mat1-Mc and Mat1-Pc

sequence feature annotate AACCCT as a GATA transcription factor binding site, seq 5'-ATCA(C/A)AACCCTAACCCT-3'do we annotate this on the genome sequence?

ams2 hip1slow cell growthallele=dbl mutant

ams2 remove NAS and TAS from artemis
ams2protein is unstable during G2 and M phase, partially stable during G1 and stable during S
ams2protein stability: is stable during S phase, level increased
ams2protein stability: is unstable during G2 phase, level decreased OR possibly only synthesised during S phase?
ams2protein stability: is unstable during G1/M phase, level increased OR possibly only synthesised during S phase?
ams2protein stability: is degraded by the SCF ubiquitin ligase pathway

double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed cnp1 = normal phenotype
double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H4 = normal phenotype
double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H3 = reduced viability (inviable ok)

cnb1,ppb1dbl deletion mutant same phenotype as each single mutant (branched,elongated multi-septate cells + slow growth in presence of mgcl2worth annotating? i.e. shows may be linked perhaps? dbl mutant not more severe
cnb1,ppb1,pmp1dbl del + overexpressed = normal cell growth
cnb1,ppb1deletion,overexpr. slow growth in presence of mgcl2i.e. large amounts of catalytic domain is not functional without regulatory subunit. is this interesting to capture?
cnb1,ppb1∆C(L445->STOPdeletion,overexpressed. slow growth in presence of mgcl2constitutively active mutant is not active without regulatory subunit
cnb1,ppb1∆C(L445->STOPoverexpressed,overexpressed. phenotype growth arrest, round small bent pear-shaped cells. depolarized distr of cortical F-actin patchesnormal phenotype in presence of CHEBI:61049
cnb1,ppb1∆C(L445->STOP,prz1overexpressed,overexpressed, deleted. no growth arrest

deletion(prz1), overexpression(ncs1)slow growthcell growth assay
deletion(ncs1), overexpression(prz1)slow growthcell growth assay
deletion(prz1), overexpression(ncs1)inviable in_response_to(CHEBI:29108)IMP
deletion(ncs1), overexpression(prz1)inviable in_response_to(CHEBI:29108)IMP
deletion(ncs1),deletion(yam8)normal cell growth in_presence_of(CHEBI:33120cell growth assay
ncs1promoter region lies in -1-130 region caact esp important
ncs1promoter for upregulation in response to calcium lies in -101-130 region
ncs1promoter for basal expression lies in -1-130 region
prz1binds caact in promoter region of ncs1

cnx1dbl mutant phenotype: abnormal cell wall morphologyallele=lumenal_cnx1p(aa_del488-560),allele=C-termTM_Cnx1p_cmyc(aa_del1-415)
cnx1some confusing data regarding apoptosis. Notes in hardcopy paperallele=lumenal_cnx1p(aa_del488-560)
cnx1allele specifications may not be 100% correct

cyr1,cgs1 dbl deletionnuclear export abolishedallele=deletion,annotation_extension=localizes(GeneDBSpombe:SPBC106.10)

map3/mam2diploid strain (CL:0000415) cannot sporulate if both receptors expressed at the same time

MatPi?expressed in response to nitrogen starvation and M factor in PcellsIDA
ste6MatPi? not expressed during N starvation and in presence of M factor in P cellsallele=deletion
ras1MatPi? not expressed during N starvation and in presence of M factor in P cellsallele=deletion
ras1MatPi? expressed during N starvation and in presence of M factor in P cells, not constitutively expressedallele=ras1val17
pat1/ras1mat1-Pm transcribedallele=pat1-114/deletion, at high temp
pat1/ste6mat1-Pm transcribedallele=pat1-114/deletion, at high temp


mfm1/mfm2FYPO:0000584 decreased sporulationallele=deletion (both)
mfm1/mfm3FYPO:0000584 decreased sporulationallele=deletion (both)
mfm2/mfm3FYPO:0000584 decreased sporulationallele=deletion (both)
mfm1/mfm2/mfm3FYPO:0000583 sporulation abolishedallele=deletion (all 3)
mfm1/mfm2/mfm3FYPO:0000583 sporulation abolishedallele=deletion (all 3),annotation_extension=in_presence_of(M-factor - externally added),annotation_extension=occurs_in:CL0002674
mfm1/mfm2/mfm3FYPO:0000590 normal sporulationallele=deletion (all 3),annotation_extension=occurs_in:CL0002674

gpa1phenotype: increased expression of MatPi? during nitrogen starvation; constitutively active. Pheromone doesn't influence transcriptionQ244L
ras1phenotype: increased expression of Matpi during nitrogen starvation in the presence of pheromoneG17V
mat1Pm/pipromoter element mapped in paper -61- -41 (ccctctttctttgttccttat

sxa2expressed in presence of p-factor
map2expressed in H- cells
cyr1/sxa2phenotype G1 arrest in presence of P-factor in rich mediaallele=deletion
cyr1/sxa2abnormal/increased shmoo formation in presence of P-factor in rich mediaallele=deletion

fkh2/fhl1reduced zygote formationallele=deletion
fkh2/mei4reduced zygote formationallele=deletion
fkh2/fhl1/mei4reduced zygote formationallele=deletion
ste11annotate promoter proximal element FLEX1 and FLEXL1 to ste11, artemis
cig2/fkh2increased zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/fhl1reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/mei4reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/fhl1/mei4reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)

ste11Unable to bind DNA region outside of the consensus motifste91

mam2negative regulation of pheromone INDEPENDENT signal transduction. TG: neg reg of GO:0038034. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)
Mam2 mutantsphenotype: constitutively active (if term goes inM cells

mam2negative regulation of pheromone INDEPENDENT signal transduction. TG: neg reg of GO:0038034. Sequesters G alpha. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)
mam2/gpa1interaction evidence is wrong, but it's the best fit....should I not curate this? I think the evidence is pretty strong

srw1 ectopically expressed | reb1 deletionnormal cell cycle arrest in response to pheromonephenotype
reb1|wee1phenotype: slow growth at high temperatureallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: multiseptate (0000118)allele=deletion(reb1)/wee1-50
reb1|wee1phenotype: weeallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: spheroid cellsallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: DNA content increasedallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: normal cell growth at high temperaturein_presence_of:CHEBI:44423, allele=deletion(reb1)/wee1-50
reb1|cdc10phenotype: slow growth at high temperatureallele=deletion(reb1)/cdc10-129
reb1|cdc10phenotype: abnormal? cell cycle arrestqualifier=at_high_temperature,allele=deletion(reb1)/cdc10-129

deletion ppb1|overexpression pmp1suppresses salt stress sensitivity
deletion pmp1|expression of const. active ppb1deltaC (C-term truncated)suppresses salt stress sensitivity
deletion pmp1|expression of const. active ppb1deltaC (C-term truncated)suppresses FK506 sensitivity
deletion pmp1|expression of ppb1 overexpressedsensitive to salt stress and FK506
deletion pmp1|deletion ppb1|deletion pmk1normal cell growth
deletion ppb1|deletionpmk1filamentous and multiseptateallele=deletion
deletion ppb1|overexpression pmp1normal morphology

stm1|ras1absence of G1 arrest in response to nitrogen starvationallele+deletion (both) flow cytometry
stm1|ras1slow cell growth in minimal media containing ammonia nitrogen sourceallele=deletion (both) cell growth assay
stm1|gpa2normal cell growth in minimal media containing ammonia nitrogen sourceannotation_extension=condition(overexpression - stm1)allele=deletion (gpa2) cell growth assay
stm1|gpa2normal septationannotation_extension=condition(overexpression - stm1)allele=deletion (gpa2) cell growth assay

mag1structure PDB ID 3S61according to authors, does not appear to match however

pyp2552 bp 5' UTR
pyp1|pyp2inviable germinating sporeallele=deletion (both)
pyp1 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_normal_temperature)
pyp2 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_normal_temperature)
pyp1 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_high_temperature)
pyp2 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_high_temperature)
pyp1 cdc2normal cell length (cell division/cell cycle)annotation_extension=condition(overexpression, pyp1), allele=cdc2-1w
pyp2 cdc2normal cell length (cell division/cell cycle)annotation_extension=condition(overexpression, pyp1), allele=cdc2-1w
pyp1 wee1elongated cellsannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_normal_temperature)
pyp2 wee1elongated cellsannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_normal_temperature)
pyp1 wee1normal cell length (possibly could use normal cell growth or normal cell division/mitotic cell cycleannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_high_temperature)
pyp2 wee1normal cell length (possibly could use normal cell growth or normal cell division/mitotic cell cycleannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_high_temperature)
pyp1 cdc25normal cell lengthallele=deletion, pyp1), allele=cdc25-22, annotation_extension=condition(at_normal_temperature)
pyp2 cdc25elongated cellsallele=deletion, pyp1), allele=cdc25-22, annotation_extension=condition(at_normal_temperature)
pyp1 cdc25elongated cellsallele=deletion, pyp1), allele=cdc25-22, annotation_extension=condition(at_high_temperature)

fas2increased accumulation of see belowallele=H201(I1276T),annotation_extension=condition(at_high_temperature)
fas2increased accumulation of see belowallele=H265(Q4Y),annotation_extension=condition(at_high_temperature)
fas2increased accumulation of see belowallele=H518(I600N),annotation_extension=condition(at_high_temperature)
fas2decreased accumulation of see belowallele=H201(I1276T),annotation_extension=condition(at_high_temperature)
fas2decreased accumulation of see belowallele=H265(Q4Y),annotation_extension=condition(at_high_temperature)
fas2decreased accumulation of see belowallele=H518(I600N),annotation_extension=condition(at_high_temperature)

For the 3 mutants above:
increased accumulation of at high temp: N-monomethyldioleoyl-PE (N-monomethyl-C18:1-C18:1-PE) N,N-dimethyl-C18:1-C18:1-PE N,N-monomethyl-C18:1-C18:1-PE N,N-dimethyl-C16:1-C18:1-PE 1-melissoyl-oleolyl-sn-glycero-3-phosphoethanolamine (C30:0-C18:1-PE) 1-melissoyl-2-oleolyl-sn-glycero-3-phosphocholine (C30:0-C18:1-PC) CHEBI:16337 CHEBI:36711

decreased accumulation of at high temp: (NOT in mutant 518) 1-oleolyl-2-caproyl-sn-glycero-3-phosphocholine (C18:1-C10:0-PC) C18:0-C10:0-PC C18:0-C8:0-PC CHEBI:18303 CHEBI:17517

pdf1dbl mutant normal growth in presence of sodium orthovanadateallele=S106A(S106A),allele=H478A(H478A) (2 plasmids)
pdf1dbl mutant normal growth in presence of sodium orthovanadateallele=D226A(D226A),allele=H478A(H478A) (2 plasmids)
pdf1dbl mutant normal growth in presence of 'near alkaline/high' pH (=condition?)allele=S106A(S106A),allele=H478A(H478A) (2 plasmids)
pdf1dbl mutant normal growth in presence of 'near alkaline/high' pH (=condition?)allele=D226A(D226A),allele=H478A(H478A) (2 plasmids)

gcs1 + ade6sensitive to cadmiumallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6sensitive to cadmiumallele=deletion,allele=ade6-210(unknown))
gcs1 + ade6normal growth in presence of either ions: Ca|Na|Mgallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6normal cell growthannotation_extension=condition(in_rich_media),allele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6resistant to MNNG (N-methyl-N'-nitro-N-nitrosoguanidine)allele=deletion,allele=ade6-210(unknown))|
gcs1 + ade6slow cell growthannotation_extension=condition(in_minimal_media),allele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6slow cell growthannotation_extension=condition(in_minimal_media),allele=deletion,allele=ade6-210(unknown)
gsh2 + ade6slow cell growthannotation_extension=condition(in_minimal_media),allele=deletion,allele=ade6-210(unknown)
hmt1 + ade6normal cell growthannotation_extension=condition(in_minimal_media),allele=deletion,allele=ade6-210(unknown)
gcs1 + ade6normal cell growthannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6normal cell growthannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=deletion,allele=ade6-210(unknown)
gsh2 + ade6normal cell growthannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=deletion,allele=ade6-210(unknown)
gcs1 + ade6sporulation abolishedallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6normal sporulationannotation_extension=in_presence_of(CHEBI:16856),allele=apd1-1(unknown),allele=ade6-210(unknown)
hmt1 + ade6red pigmentation of coloniesallele=deletion,allele=ade6-210(unknown)
gcs1 + ade6absent/reduced red pigmentation of coloniesallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6absent/reduced red pigmentation of coloniesallele=deletion,allele=ade6-210(unknown)
gsh2 + ade6reduced red pigmentation of coloniesallele=deletion,allele=ade6-210(unknown)
gcs1 + ade6absent/reduced red pigmentation of coloniesannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=apd1-1(unknown),allele=ade6-210(unknown)

ade2/ade6dbl mutant sensitive to cadmiumallele=ade6-216(unknown),allele=ade2(deletion), growth assay
ade2/ade7dbl mutant sensitive to cadmiumallele=ade7-50(unknown),allele=ade2(deletion), growth assay
-asked for a term to describe HMW complex. Link to it
ade2/ade6dbl mutant can't accumulate HMW PC-Cd-S2- complexallele=ade6-216(unknown),allele=ade2(deletion)
ade2/ade7dbl mutant can't accumulate HMW PC-Cd-S2- complexallele=ade7-50(unknown),allele=ade2(deletion)
-asked for a term to describe HMW complex. Link to it - GO:0090424

SPAC3H1.10MOD requested: cadmium containing modified residueresidue=C173|

ade2 + ade7sensitive to cisplatinallele=deletion (ade2) allele=ade7.50
ade2 + ade6sensitive to cisplatinallele=deletion (ade2) allele=ade6.216

perhaps should use +ve reg of transcr instead of calcium response for the var agentsgo over again

gef1delta + orb6-25 normal morphology at high tempmicroscopy
rga4 overexpressed + orb6-25 normal morphology at high tempmicroscopy
Gef1 overexpression + orb6-as2stubby PCO:0000005 at normal temp
orb6-25 + rga4deltastubby at normal temp PCO:0000005

rgs1decreased transcriptional response in response to pheromoneallele=noname(overexpression),​​annotation_extension=occurs_in(CL:0002674)
gpa1can probably migrate some terms to abnormal decrease in transcription/increase, see what midori says

dak1/dak2 dbl mutnormal cell growthallele=dak1-delta(deletion),allele=dak2-delta(deletion),condition=PCO:0000014
dak1/dak2decreased glycerol dehydrogenase activityallele=dak1-delta(deletion),allele=dak2-delta(deletion),condition=PCO:0000072
dak1/dak2increased accumulation of DHAallele=dak1-delta(deletion),allele=dak2-delta(deletion),condition=PCO:0000072
dak1/dak2slow aerobic cell growthallele=dak1-delta(deletion),allele=ak2-delta(deletion),condition=PCO:0000072
dak1/dak2/gld1abolished glycerol dehydrogenase activityallele=dak1-delta(deletion),allele=dak2-delta(deletion),allele=gld1-delta(deletion),condition=PCO:0000072
dak1/dak2slow aerobic cell growthallele=dak1-delta(deletion),allele=ak2-delta(deletion),condition=PCO:0000073
dak1/dak2slow aerobic cell growthallele=dak1-delta(deletion),allele=ak2-delta(deletion),condition=PCO:0000076,condition=PCO:0000014
tup11/tup12increased glycerol dehydrogenase activityallele=tup11-delta(deletion),allele=tup12-delta(deletion),condition=PCO:0000014
gld1/dak1/dak2slow cell growthallele=noname(overexpression),condition=PCO:0000077

atf1 + pap1sensitive to cisplatinallele=atf1-delta(deletion), allele=pap1-delta(deletion), condition=PCO:0000012, CGA

crm1 + pap1normal growth at cold /or/ normal cell growth condition=low tempallele=crm1-809(unknown),allele=pap1-delta(deletion),PCO:0000012
crm1 + pap1sensitive to staurosporineallele=crm1-809(unknown),allele=pap1-delta(deletion),PCO:0000012
crm1 + pap1normal protein accumulationallele=crm1-809(unknown),allele=pap1-delta(deletion),annotation_extension=has_regulation_target(PomBase:SPAC3C7.14c)

rpn11| pmd1resistant to K-252aallele=pmd1-delta(deletion),allele=noname(overexpression),​condition=PCO:0000012
rpn11| pmd1resistant to staurosporineallele=pmd1-delta(deletion),allele=noname(overexpression),​condition=PCO:0000012
rpn11| pmd1resistant to vanadateallele=pmd1-delta(deletion),allele=noname(overexpression),​condition=PCO:0000012
rpn11| pmd1resistant to cycloheximideallele=pmd1-delta(deletion),allele=noname(overexpression),​condition=PCO:0000012
rpn11| pmd1resistant to actinomycin Dqualifier=NOT, allele=pmd1-delta(deletion),allele=noname(overexpression),​condition=PCO:0000012
rpn11| pmd1resistant to thiabendazolequalifier=NOT, allele=pmd1-delta(deletion),allele=noname(overexpression),​condition=PCO:0000012

cia1 | mts2increased protein level allele=asf1-30(F24S,​G120S,​D173G), allele=mts2-1(unknown), condition=PCO:0000004,annotation_extension=has_regulation/downstream_target(PomBase:SPCC663.05c), western
cia1 | mts2slow growth allele=asf1-30(F24S,​G120S,​D173G), allele=mts2-1(unknown), condition=PCO:0000005, condition=PCO:0000012, CGA
cia1 | mts2slow growth at high temp allele=asf1-30(F24S,​G120S,​D173G), allele=mts2-1(unknown), condition=PCO:0000012, CGA
cia1 | ubc4slow growth allele=asf1-30(F24S,​G120S,​D173G), allele=ubc4ts(P61S), condition=PCO:0000005, condition=PCO:0000012, CGA
cia1 | ubc4slow growth at high temp allele=asf1-30(F24S,​G120S,​D173G), allele=ubc4ts(P61S), condition=PCO:0000012, CGA
cia1 + mts2FYPO:0000783, cia1 normally found in nucleus, but here found in cytoplasmallele=asf1-30(F24S,​G120S,​D173G),allele=mts2-1(unknown), condition=PCO:0000004, specify cia in annex? has_target cia1?
cia1 | ubc4increased protein level allele=asf1-30(F24S,​G120S,​D173G), allele=ubc4ts(P61S), condition=PCO:0000004,annotation_extension=has_regulation/downstream_target(PomBase:SPCC663.05c), western
cia1 | SPBC2A(.04Cincreased protein level allele=asf1-30(F24S,​G120S,​D173G), allele=san1-delta(deletion), condition=PCO:0000004,annotation_extension=has_regulation/downstream_target(PomBase:SPCC663.05c), western
cia1 | hrd1 slow growth at normal temp allele=asf1-30(F24S,​G120S,​D173G),allele=hrd1-delta(deletion), condition=PCO:0000012
cia1 | hrd1 slow growth at high temp allele=asf1-30(F24S,​G120S,​D173G),allele=hrd1-delta(deletion), condition=PCO:0000012
cia1 | doa10 slow growth at normal temp allele=asf1-30(F24S,​G120S,​D173G),allele=doa10-delta(deletion), condition=PCO:0000012
cia1 | doa10 slow growth at high temp allele=asf1-30(F24S,​G120S,​D173G),allele=doa10-delta(deletion), condition=PCO:0000012
cia1 | san1 normal cell growth allele=asf1-30(F24S,​G120S,​D173G),allele=san1-delta(deletion), condition=PCO:0000012, condition=PCO:0000006
cia1 | san1 slow growth at high temp allele=asf1-30(F24S,​G120S,​D173G),allele=san1-delta(deletion), condition=PCO:0000012
cia1 | ubr1 normal cell growth allele=asf1-30(F24S,​G120S,​D173G),allele=ubr1-delta(deletion), condition=PCO:0000012, condition=PCO:0000006
cia1 | ubr1 slow growth at high temp allele=asf1-30(F24S,​G120S,​D173G),allele=ubr1-delta(deletion), condition=PCO:0000012
cia1 | ubr11 normal cell growth allele=asf1-30(F24S,​G120S,​D173G),allele=ubr11-delta(deletion), condition=PCO:0000012, condition=PCO:0000006
cia1 | ubr11 slow growth at high temp allele=asf1-30(F24S,​G120S,​D173G),allele=ubr11-delta(deletion), condition=PCO:0000012
SPBC2A9.04c | mis12 normal cell growth at high tempallele=san1-delta(deletion),allele=mis12-537(unknown), condition=PCO:0000012, condition=PCO:0000012
SPBC2A9.04c | pim1 normal cell growth at high tempallele=san1-delta(deletion),allele=pim1-46(unknown), condition=PCO:0000012, condition=PCO:0000012
SPBC2A9.04c | cnp1 normal cell growth at high tempallele=san1-delta(deletion),allele=cnp1-1(unknown), condition=PCO:0000012, condition=PCO:0000012

mfm1dbl check annotations, allele descr for phenotype annotationhas_regulation_target(PomBase:SPMTR.02))

end4normal nuclear / medial cortex morphology during nitrogen starvation allele=end4-507(G73D), condition=PCO:0000098, microscopy
end4abnormal nuclear / medial cortex morphology during nitrogen starvation allele=end4-507(G73D), condition=PCO:0000097, microscopy

frp1abolished ferric iron reductase activity, not req yetallele=G-100(W314->opal)
waiting reply from val on paper

rds1cellular response to adenine starvation, term reqIMP - IEP is more appropriate perhaps..
ade genesfor FYPO:0000825 annotation add 'during cellular response to adenine starvation' term reqdon't add for cyr1
rds1 /controlled_curation="term=gene expression, mRNA level; annotation_extension=during(cellular response to adenine starvation); qualifier=increased; evidence=ECO:0000106; db_xref=7565608; date=20120504"

pck2 increased protein tyrosine phosphorylationallele=pck2delta(deletion),​​ annotation_extension=assayed_using(PomBase:SPBC119.08)
pmk1 | spk1sterileallele=pmk1delta(deletion), allele=spk1delta(deletion)
pmk1 | spk1abnormal morphologyallele=pmk1delta(deletion), allele=spk1delta(deletion), condition=PCO:0000014, condition=PCO:0000102
pmk1 | spk1normal response to salt stressallele=pmk1delta(deletion), allele=spk1delta(deletion), condition=PCO:0000014, condition=PCO:0000102
wis1 | pmk1 multiseptate microscopy, allele=wi1delta(deletion), allele=pmk1delta(deletion), condition=PCO:0000014, condition=PCO:0000102

tnr1increased RNA level, northern evidence, need to find what this gene is...allele=tnr1-18(unknown), annotation_extension=assayed_using(SPBC26H8.01),​ condition=PCO:0000014,​ annotation_extension=happens_during(GO:0071301)
tnr1cellular response to vitamin b1 - which gene is this?? IMP
thi2gene expression: expressed in response to thiamine starvation. repressed in response to thiamine....
/controlled_curation="term=gene expression, mRNA level; annotation_extension=during(GO:0036225); qualifier=increased; evidence=ECO:0000106; db_xref=1644306; date=20120509"
/controlled_curation="term=gene expression, mRNA level; annotation_extension=during(GO:0071301); qualifier=absent; evidence=ECO:0000106; db_xref=1644306; date=20120509"
/controlled_curation="term=gene expression, mRNA level; annotation_extension=in_response_to(CHEBI:16892); qualifier=increased; evidence=ECO:0000106; db_xref=1644306; date=20120509"
/controlled_curation="term=gene expression, mRNA level; annotation_extension=in_response_to(CHEBI:17957); qualifier=decreased; evidence=ECO:0000106; db_xref=1644306; date=20120509"

tnr3 increased thiamine level, chromatography evidence - requested form eco:, allele=tnr3-10(unknown)
tnr3 increased thiamine levelallele=pho1-44delta(deletion), allele=tnr3-5(unknown)
tnr3 increased thiamine levelallele=pho1-44delta(deletion), allele=tnr3-1(unknown)
pho4cellular response to thiamine starvationIMP

tnr1which gene is this? FYPO:0000825 northern evallele=tnr1-18(unknown), condition=PCO:0000014, annotation_extension=assayed_using(SPAC17A2.01)
bsu1cellular response to thiamine starvationIMP
thi3 | bsu1 slow aerobic cell growth allele=bsu1delta(deletion), allele=thi3-1(unknown), condition=PCO:0000014, condition=PCO:0000106
thi3 | bsu1 slow aerobic cell growth allele=bsu1delta(deletion), allele=thi3-1(unknown), condition=PCO:0000014, condition=PCO:0000107


/controlled_curation="term=gene expression, mRNA level; annotation_extension=during(cellular response to thiamine starvation); qualifier=increased; evidence=ECO:0000106; db_xref=2249257; date=20120510"


itr2 | itr1 normal cell growth allele=IM49(unknown),​​ allele=itr1-noname(overexpression), condition=PCO:0000005,​​ condition=PCO:0000014,​​ condition=PCO:0000102,​ condition=PCO:0000111

tpx1 | srx1 normal cellular response to hydrogen peroxideallele=srx1(overexpression), allele=tpx1(deletion)

gpx1 | ctt1 normal response to hydrogen peroxide ctt1=deleted, gpx1=overexpressed, 30 degrees
transcription factor deletionsreuest terms for during h202 and normal growthsee paper annotations

hxk1/hxk2slow growth on glucose carbon sourcedouble-deletion

pma mutantnormal ATPase activity unknown, in vitro
pma mutantnormal H+/hydrogen export/transport activity unknown, in vitro
pma mutantNormal enzyme in vitro response to Dio-9 unknown, in vitro
pma mutantNormal enzyme in vitro response to DCCD N,N'-dicyclohexylcarbodiimideunknown, in vitro
pma mutantNormal enzyme in vitro response to Miconazoleunknown, in vitro
pma mutantNormal enzyme in vitro response to DES diethylstilbestrolunknown, in vitro
pma mutantNormal enzyme in vitro response to Suloctidil unknown, in vitro
pma mutantNormal enzyme in vitro response to p-hydroxymercuribenzoate unknown, in vitro
pma mutantNormal enzyme in vitro response to protamine sulfate unknown, in vitro
pma mutantNormal enzyme in vitro response to decamethylene diguanidineunknown, in vitro
ade7-413|pma mutant slow growth adenine added, MM, liquid media
pma mutant decreased methionine transport into cell during nitrogen starvation
pma mutant decreased cellular pH CGAYE liquid

varsee notes in session. May have to req new binding terms or define cofactor binding which influence activity elsewise. The cofactors are not strictly required_for, but rather catalyse/decrease activity
dextrin alpha-glucosidase activity qualifier=majorIDA
starch alpha-glucosidase activity qualifier=majorIDA

inv1|sut1slow growth on sucroseallele=deletion(both), sucrose MM
inv1|sut1slow growth on trehaloseallele=deletion(both), trehalose MM
inv1|sut1normal growth on maltoseallele=deletion(both), maltose MM

uvi15loss of viability in stationary phase upon nitrogen depletiondeletion, glucose min medium, normal temp

itr2swap myo-inositol transport for myo-inositol transport into cell

crm1integrate two BPs, have requested term from GO
other assaysRNA protection assay or transcript quantification assay

san1BP GO:1901044 Label: protein polyubiquitination involved in nucleus-associated proteasomal ubiquitin-dependent protein catabolic processIMP
agl1soluble starch alpha-glucosidase activityIDA
agl1maltase activityenzyme assay data alleles are:


abolished: D481N/E/A, E484Q/A, and D647N/E/A

gpt1oligosaccharide glucosylation, child of macromolecule glycosylationIMP
alg6decreased glc1man9GlcNAc levelDNJ added, chromatography, deletion
alg6absent glc2man9GlcNAcDNJ added, chromatography, deletion
alg6absent glc3man9GlcNAcDNJ added, chromatography, deletion
alg6increased man9GlcNAcDNJ added, chromatography, deletion
alg6increased man8GlcNAcDNJ added, chromatography, deletion
alg6decreased glc1man9GlcNAc levelchromatography, deletion
alg6|gpt1decreased glc1man9GlcNAc levelDNJ added, chromatography, deletion of both
alg6|gpt1increased man9GlcNAc levelDNJ addedchromatography, deletion of both
alg6|gpt1absent glc2man9GlcNAcDNJ added, chromatography, deletion of both
alg6|gpt1absent glc3man9GlcNAcDNJ added, chromatography, deletion of both
alg6|gpt1decreased glc1man9GlcNAc levelchromatography, deletion of both
alg6|gpt1decreased man9GlcNAc levelchromatography, deletion of both
alg6|gpt1absent glc2man9GlcNAcchromatography, deletion of both
alg6|gpt1absent glc3man9GlcNAcchromatography, deletion of both
gls2|alg6absent glc2man9GlcNAcchromatography, deletion of both
gls2|alg6absent glc3man9GlcNAcchromatography, deletion of both
gls2|alg6increased glc1man9GlcNAcchromatography, deletion of both
gls2|alg6increased man9GlcNAcchromatography, deletion of both
gls2|alg6increased man8GlcNAcchromatography, deletion of both
gpt1|alg6increased RNA levelnorthern, annotation_extension=assayed_using(PomBase:SPAC22A12.15c)
gpt1|alg6increased RNA levelnorthern, annotation_extension=assayed_using(PomBase:SPAC22A12.15c)
alg6lower cell density in stationary phasedeletion, glucose minimal medium, liquid, normal temp
gpt1 | alg6lower cell density in stationary phasedeletion, glucose minimal medium, liquid, normal temp
gpt1 | alg6slower cell growth ratedeletion, glucose minimal medium, liquid, normal temp
gpt1 | alg6flocculating cells, microscopydeletion, glucose minimal medium, normal temp
gpt1 | alg6round/swollen cells (they are not small), microscopydeletion, glucose minimal medium, normal temp
gpt1 | alg6slow growth at high temperaturedeletion, glucose minimal medium, normal temp
gls2 | alg6slow aerobic cell growth on glucose carbon sourcenormal glucose MM, high temp, agar plates
gls2 | alg6normal aerobic cell growth on glucose carbon sourcenormal glucose MM, normal temp
gpt1 | alg6slow aerobic cell growth on glucose carbon sourcenormal glucose MM, normal temp, agar plates
gpt1 | alg6slow aerobic cell growth on glucose carbon sourcenormal glucose MM, high temp, agar plates
deletion alg6 | overexpressed gpt1normal cell growthplate, normal glucose MM, normal temp
deletion alg6 | overexpressed gpt1normal cell growthplate, normal glucose MM, high temp
gpt1|alg6normal morphologydeletion, sorbitol added, normal glucose MM, liquid
gpt1|alg6normal cell growth on gluocose carbon sourcedeletion, sorbitol added, normal glucose MM
deletion alg6 | overexpressed gpt1normal morphologynormal glucose MM, high temp
deletion alg6| deletion gpt1|overexpression gpt1(Y1312A,D1352A)round/swollen cellsnormal temp, glucose MM
deletion alg6| deletion gpt1|overexpression gpt1(Y1312A,D1352A)slow growth at high temphigh temp, glucose MM
gls2 | alg6normal morphologynormal glucose MM, normal temp

yam8 | pck2normal growth at high tempallele=ehs1-1, allele=pck2(overexpressed),high temp, YES
yam8 | pck2slow growth at high tempallele=yam8delta, allele=pck2(overexpressed),high temp, YES
yam8 | pck2normal conjugation freqallele=ehs1-1, allele=pck2(overexpressed)
yam8 | pck2decreased conjugation freqallele=yam8delta, allele=pck2(overexpressed)
yam8 | pck2normal growth on cilofunginallele=ehs1-1, allele=pck2(overexpressed),normal temp, YES
yam8 | pck2sensitive to cilofunginallele=yam8delta, allele=pck2(overexpressed),normal temp, YES
yam8 | pck2normal growth on calcofluor whiteallele=ehs1-1, allele=pck2(overexpressed),normal temp, YES
yam8 | pck2sensitive to calcofluor whiteallele=yam8delta, allele=pck2(overexpressed),normal temp, YES
yam8 | pck2slow growthallele=pck2(overexpression),allele=ehs1-1, solid agar plates, glucose minimal medium, standard temperature
yam8 | pck2normal cell growthallele=pck2(overexpression),allele=ehs1-1, calcium excluded, solid agar plates, glucose minimal medium, standard temperature
yam8 | pck2 normal growthallele=pck2(overexpression),allele=yam8delta, solid agar plates, glucose minimal medium, standard temperature
yam8 | pck2 normal growthallele=pck2(overexpression),allele=yam8delta, calcium excluded, solid agar plates, glucose minimal medium, standard temperature
yam8 | pck2normal level of calcium in cellallele=ehs1-1, allele=pck2(overexpression), normal temp, glucose MM
yam8 | pck2inviableallele=ehs1-1, allele=pck2delta
yam8 | pck2viableallele=yam8delta, allele=pck2delta
yam8 | pck2normal morphologyallele=pck2(overexpression),allele=yam8delta, glucose MM, standard temp microscopy
yam8 | pck2lysed cellsallele=pck2(overexpression),allele=ehs1-1, glucose MM, standard temp microscopy
yam8 | pck1sensitive to calcofluor whiteallele=ehs1-1, allele=pck1(overexpressed),normal temp, YES
yam8 | pck1sensitive to cilofunginallele=ehs1-1, allele=pck1(overexpressed),normal temp, YES
yam8 | pck1slow growth at high tempallele=ehs1-1, allele=pck1(overexpressed),high temp, YES

missing annotations

HTP gene expression data
15004206for future ref
19366728table 3 + gene expression omnibus GEOhashGSE14319for future ref

misc to add
positive reg of protein targeting to vacuolar membrane