
Version 60 (modified by antonialock, 10 years ago) (diff)


gene term extension
dmr1 (ppr3)mitochondrial translation phenotype, less translation of mt proteinsallele=deletion
variousadd missing phenotype alleles

gene term extension
lkh1expressionupregulated during mitosis and cytokinesis (=mitotic cell cycle) (IDA)
lkh1, dsk1((phenotype)) severe growth defect (cell growth assay)allele=Δdsk1Δlkh1

gene term extension
rtt109Delta rtt109/Histone H3 K56R double-mutant phenotypeasynthetic sensitivity to DNA damage

gene term extension
mam1annotation_extension= does not ...
mam1how to capture transcription increased to nitrogen starvation?
mam1how to capture transcription increased in response to pheromone?

gene term extension
map1 expression suppressed in 2674. annotation_extension= doesnot occurs_in(CL:0002674 (but does occur in 2675)

gene term extension
mat1-Pcconstitutively expressed (how to capture expression pattern?)annotation_extension=occurs_in(CL:0002675)
mat1-PcUpregulated in response to nitrogen starvation (how to capture expression pattern?)annotation_extension=occurs_in(CL:0002675)
mat1-PiExpressed in response to nitrogen starvation (how to capture expression pattern?)annotation_extension=occurs_in(CL:0002675)
map1regulation of transcription, mating-type specificannotation_extension=occurs_in(CL:0002675)
map1transcription regulation phenotypeadd to annotation extension condition/during=nitrogen_starvation 2 annotations for this (2 targets, pi and pc)
map1transcription regulation phenotypeadd to annotation extension that transcription is downregulated (2 targets, pi and pc)
map1abnormal premeiotic DNA replication initiationallele=deletion

gene term extension
mat2-P...or mat2-Pc/Pi?Silenced (waiting for GeneDB to update cassette info so this can be annotated)IMP mat1-
mat3-M...or mat3-Mc/Mi?Silenced (waiting for GeneDB to update cassette info so this can be annotated)IMP mat1-
mat1-MiPhenotype: can conjugate but not undergo meiosis/sporulateallele=Mifs15(del_nt43-129)
mat1-PiPhenotype: can conjugate but not undergo meiosis/sporulateallele=Piop7(del_nt19-357)
mat1-PcPhenotype: can't conjugateallele=Pcop5(del_nt17-480)
mat1-McPhenotype: can't conjugateallele=Mcop7(del_nt19-546)
mat1-Pcsevere reduction in spore formationallele=deletion
mat1-Pcprocess: required for efficient meiosisIMP, allele=deletion
mat1-Mcprocess: required for efficient meiosisIMP, allele=deletion
mat1-Pcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Pcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Mcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Mcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Piexpression: not expressed (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Piexpression: not expressed (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Miexpression: not expressed (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Miexpression: not expressed (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
All 4 are upregulated in response to nitrogen starvation. In diploid; downregulation at 6h compared to 4h, in haploid; no downregulation

geneterm extension
map1transcription phenotype, target is not upregulated in response to nitrogen starvationallele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-PC,(strain is H90))
mat1-Pcpositive autoregulation of transcription in response to nitrogen starvationallele=mat1-Pc-161()
map1transcription phenotype, target is not expressed in response to nitrogen starvationallele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm,(strain is H90))
mat1-Pctranscription phenotype, target is not expressed in response to nitrogen starvationallele=mat1-Pc-161(),annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm,(strain is H90))
mat1-Pclow constitutive expression in rich mediaallele=H90(fus1 deletion)
mat1-Pmno constitutive expression in rich mediaallele=H90(fus1 deletion)
mat1-Pmexpression in response to nitrogen starvation is dependent on the presence of CL:0002674annotation_extension=occurs_in(CL:0002675)
mat1-Pcupregulation in response to nitrogen starvation is not dependent on the presence of CL:0002674annotation_extension=occurs_in(CL:0002675)
ran1process: negative regulation of transcription from RNA polymerase II promoter during mitosis (IMP evidence code)allele=pat1-114,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm, mat1-Mc and Mat1-Pc

gaf1phenotype: has DNA binding activityallele=Gaf1N(AA1-120)
gaf1phenotype: abolished DNA binding activityallele=GAF1C(121-290)

ams2expression oscillates during cell cycle, peaks at S-phase (except hht2 which remain constant)
ams2delayed septationallele=deletion
ams2DNA replication appears normalallele=deletion
ams2RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcriptionadd extension: annotation_extension=acts_at(SO: GATA transcr factor - term is requested)
ams2 + hht2synthetic lethality, double mutantallele=deletion
sequence feature annotate AACCCT as a GATA transcription factor binding site, seq 5'-ATCA(C/A)AACCCTAACCCT-3'artemis?
ams2CC nuclear chromosomeacts at(SO:GATA transcr factor binding site

ams2 hip1slow cell growthallele=dbl mutant

ams2 remove NAS and TAS from artemis
ams2protein is unstable during G2 and M phase, partially stable during G1 and stable during S
ams2protein stability: is stable during S phase, level increased
ams2protein stability: is unstable during G2 phase, level decreased OR possibly only synthesised during S phase?
ams2protein stability: is unstable during G1/M phase, level increased OR possibly only synthesised during S phase?
ams2protein stability: is degraded by the SCF ubiquitin ligase pathway
ams2allele=overexpression(overexpression and allele=deletion(deletion)...correct way of writing this is?

double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed cnp1 = normal phenotype
double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H4 = normal phenotype
double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H3 = reduced viability (inviable ok)
sim3go biological process: protein localization to kinetochoreannotation_extension=does not happens_during G1

cnb1,ppb1dbl deletion mutant same phenotype as each single mutant (branched,elongated multi-septate cells + slow growth in presence of mgcl2worth annotating? i.e. shows may be linked perhaps? dbl mutant not more severe
cnb1,ppb1,pmp1dbl del + overexpressed = normal cell growth
cnb1,ppb1deletion,overexpr. slow growth in presence of mgcl2i.e. large amounts of catalytic domain is not functional without regulatory subunit. is this interesting to capture?
cnb1,ppb1∆C(L445->STOPdeletion,overexpressed. slow growth in presence of mgcl2constitutively active mutant is not active without regulatory subunit
cnb1,ppb1∆C(L445->STOPoverexpressed,overexpressed. phenotype growth arrest, round small bent pear-shaped cells. depolarized distr of cortical F-actin patchesnormal phenotype in presence of CHEBI:61049
cnb1,ppb1∆C(L445->STOP,prz1overexpressed,overexpressed, deleted. no growth arrest

∆yam8not involved in calcium response in presence of cacl2 or chlorpromazineIMP - phenotype decreased cellular signalling?
∆cch1not involved in calcium response in presence of cacl2 or chlorpromazineIMP

ncs1expression:upregulated in response to CHEBI:29108 NOT upregulated in response to CHEBI:6636, CHEBI:26710, CHEBI:32588, CHEBI:30911, CHEBI:32035, or CHEBI:61049IDA
deletion(prz1), overexpression(ncs1)slow growthcell growth assay
deletion(ncs1), overexpression(prz1)slow growthcell growth assay
deletion(prz1), overexpression(ncs1)inviable in_response_to(CHEBI:29108)IMP
deletion(ncs1), overexpression(prz1)inviable in_response_to(CHEBI:29108)IMP
deletion(ncs1),deletion(yam8)normal cell growth in_presence_of(CHEBI:33120cell growth assay
ncs1promoter region lies in -1-130 region caact esp important
ncs1promoter for upregulation in response to calcium lies in -101-130 region
ncs1promoter for basal expression lies in -1-130 region
prz1binds caact in promoter region of ncs1

ncs1upregulated in response to CaCl2+

acr1phenotype:ringlike nuclear chromatinallele=acr1-936, requested term
nuc1phenotype:ringlike nuclear chromatinallele=nuc1-632, requested term
cut14phenotype=abnormal nucleolar rDNA separationallele=cut14-208,qualifier=at_high_temperature

rst2in a ∆pka1 mutant and sam5 and sam7 rst2 is phosphorylated under normal conditions (not in wt)
pka1normal protein localization
pka1normal protein localizationannotation_extension=exists_during:GO:0042149)

cnx1dbl mutant phenotype: abnormal cell wall morphologyallele=lumenal_cnx1p(aa_del488-560),allele=C-termTM_Cnx1p_cmyc(aa_del1-415)
cnx1some confusing data regarding apoptosis. Notes in hardcopy paperallele=lumenal_cnx1p(aa_del488-560)
cnx1allele specifications may not be 100% correct

cyr1,cgs1 dbl deletionnuclear export abolishedallele=deletion,annotation_extension=localizes(GeneDBSpombe:SPBC106.10)
cgschange annotation concerning localized to nucleus during GO:0009651 to nucleus excluding nucleoluswaiting to see if GO will give a term for this cellular component

pik3-/pik3-spore germination abolished, abnormal spore morphologyif a more specified term is added to CL then change CL:0000415 to homozygous diploid, if not then add allele=homozygous?
pik3-/pik3+FYPO:0000579 normal spore germinationadd this with either CL:0000415 + allele=heterozygous or more specific CL if given
pik3have requested 2 process terms from GO (+ve regulation of protein targeting to prospore/vacuolar membraneupdate if granted
pik3abnormal protein targeting to prospore membrane phenotypeallele=deletion,annotation_extension=localizes(PF:01363)

plc1qualifier in genedb for binding:"N-term", not clear if it binds N-term or if it binds via N-term"

matPimRNA levels increase in response to M-factoroccurs_in(CL:0002675

krp1abolished enzymatic activityallele=R82A, qualifier=in_vitro

sxa2Normal carboxypeptidase activityK309A
sxa2Normal carboxypeptidase activityK309A,R310K
sxa2No carboxypeptidase activityK309A,R310A
sxa2No carboxypeptidase activityS460*(delS460-Y507)
sxa2No carboxypeptidase activity563(W247->amber
sxa1remove the artemis annotation to BP conjugation with cellular fusion

map3/mam2diploid strain (CL:0000415) cannot sporulate if both receptors expressed at the same time

MatPi?expressed in response to nitrogen starvation and M factor in PcellsIDA
ste6MatPi? not expressed during N starvation and in presence of M factor in P cellsallele=deletion
ras1MatPi? not expressed during N starvation and in presence of M factor in P cellsallele=deletion
ras1MatPi? expressed during N starvation and in presence of M factor in P cells, not constitutively expressedallele=ras1val17
pat1/ras1mat1-Pm transcribedallele=pat1-114/deletion, at high temp
pat1/ste6mat1-Pm transcribedallele=pat1-114/deletion, at high temp
mfm1/mfm2FYPO:0000584 decreased sporulationallele=deletion (both)
mfm1/mfm3FYPO:0000584 decreased sporulationallele=deletion (both)
mfm2/mfm3FYPO:0000584 decreased sporulationallele=deletion (both)
mfm1/mfm2/mfm3FYPO:0000583 sporulation abolishedallele=deletion (all 3)
mfm1/mfm2/mfm3FYPO:0000583 sporulation abolishedallele=deletion (all 3),annotation_extension=in_presence_of(M-factor - externally added),annotation_extension=occurs_in:CL0002674
mfm1/mfm2/mfm3FYPO:0000590 normal sporulationallele=deletion (all 3),annotation_extension=occurs_in:CL0002674
mfm1expressed in CL:0002674happens during(GO:0006995) - cellular response to nitrogen starvation
mfm2expressed in CL:0002674happens_during(GO:0000278) - mitotic cell cycle
mfm2expression increased in CL:0002674happens during(GO:0006995) - cellular response to nitrogen starvation
mfm3expressed in CL:0002674happens during(GO:0006995) - cellular response to nitrogen starvation
mfm1not expressed in CL:0002675
mfm2not expressed in CL:0002675
mfm3not expressed in CL:0002675
mfm1expression increasedannotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation
mfm2expression increasedannotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation
mfm3expression increasedannotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation

mfm1/2/3Add on gene page that the final peptide gene product is 9 amino acids long and consists of YTPKVPYM

gpa1phenotype: increased expression of MatPi? during nitrogen starvation; constitutively active. Pheromone doesn't influence transcriptionQ244L
ras1phenotype: increased expression of Matpi during nitrogen starvation in the presence of pheromoneG17V
mat1Pm/pipromoter element mapped in paper -61- -41 (ccctctttctttgttccttat

krp1expressed in mitotically growing cells
krp1expressed in response to nitrogen starvation
krp1dibasic endopeptidase activity - have one for serine peptidase activity, use that one?need to request term

sxa2expressed in presence of p-factor
map2expressed in H- cells
cyr1/sxa2phenotype G1 arrest in presence of P-factor in rich mediaallele=deletion
cyr1/sxa2abnormal/increased shmoo formation in presence of P-factor in rich mediaallele=deletion

fkh2reduced zygote formationallele=deletion
fhl1reduced zygote formationallele=deletion
mei4reduced zygote formationallele=deletion
fkh2/fhl1reduced zygote formationallele=deletion
fkh2/mei4reduced zygote formationallele=deletion
fkh2/fhl1/mei4reduced zygote formationallele=deletion
ste11annotate promoter proximal element FLEX1 and FLEXL1 to ste11, artemis
fkh2reduced zygote formationallele=T314E
fkh2reduced zygote formationallele=S462E
fkh2normal zygote formationallele=S481E
fkh2reduced zygote formationallele=T314E,S462E,S481E
fkh2normal zygote formationallele=T314A,S462A,S481A
fkh2normal cell morphologyallele=T314E
fkh2normal cell morphologyallele=S462E
cig2increased rate of zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2increased zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/fhl1reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/mei4reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/fhl1/mei4reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)

mat1have annotated M specific genes to the genes closest to the centromere (around 2120000). eg mat3m, matmc_2 NOT mat1-m or matmc_1. I think this is correct but dbl-check once artemis files are updated on genedb
mat1-mm)expressed in response to P-factor and nitrogen starvationIDA
mat1-pmexpressed in response to nitrogen starvationIDA

ste11Unable to bind DNA region outside of the consensus motifste91

krp1abolished serine endopeptidase activityallele=S371A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=K81I,R82A,R102K,S371A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=R82A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=K81I,R82A ODA, qualifier=in_vitro
krp1normal serine endopeptidase activityallele=R102K ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=R82A,R102K ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=I81I,R82AR102K ODA, qualifier=in_vitro
krp1reduced serine endopeptidase activityallele=R102A ODA, qualifier=in_vitro
krp1reduced serine endopeptidase activityallele=R82A,R102A ODA, qualifier=in_vitro
krp1reduced serine endopeptidase activityallele=K81I,R82A,R102A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=aa_del579-709 ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=aa_del591-709 ODA, qualifier=in_vitro
krp1normal serine endopeptidase activityallele=aa_del612-709 ODA, qualifier=in_vitro

krp1no enzymatic activity (abolished serine endopeptidase activity)allele=S271A ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R102K ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R82A ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=R82A,R102K ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R82A,R102K,qualifier=overexpression ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=R102A ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R102A,qualifier=overexpression ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=R82A,R102A ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R82A,R102A,qualifier=overexpression ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=aa_del579-709 ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=aa_del591-709 ODA

mam2negative regulation of pheromone INDEPENDENT signal transduction. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)
Mam2 mutantsphenotype: constitutively active (if term goes inM cells

mam2negative regulation of pheromone INDEPENDENT signal transduction. Sequesters G alpha. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)
Mam2P261Lphenotype: constitutively active (if term goes inM cells
mam2cellular component, homodimeric complex; will come under GO:0043235IDA
mam2/gpa1interaction evidence is wrong, but it's the best fit....should I not curate this? I think the evidence is pretty strong

rgs1phenotype: increased sensitivity to pheromoneallele=deletion, in M cells

srw1another phenotype: decreased cell cycle arrest in response to pheromoneallele=mutPste9(A->C and G-> T and vice versa throughout 27 bp reb1 binding region -198 - -172
srw1decreased sporulationmutPste9
srw1 ectopically expressed | reb1 deletionnormal cell cycle arrest in response to pheromonephenotype
reb1|wee1phenotype: slow growth at high temperatureallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: multiseptate (0000118)allele=deletion(reb1)/wee1-50
reb1|wee1phenotype: weeallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: spheroid cellsallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: DNA content increasedallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: normal cell growth at high temperaturein_presence_of:CHEBI:44423, allele=deletion(reb1)/wee1-50
reb1|cdc10phenotype: slow growth at high temperatureallele=deletion(reb1)/cdc10-129
reb1|cdc10phenotype: abnormal? cell cycle arrestqualifier=at_high_temperature,allele=deletion(reb1)/cdc10-129
reb1 change cell cycle arrest in mitotic G1 phase to "increased rate of"allele=overexpression

ins1negative regulation of the mevalonate pathway, negative regulation of HMG-CoA reductase activityIMP, regulates phosphorylation of hmg1, annotation_extension=in_absence_of(CHEBI:16646) (sugar)
sds23negative regulation of the mevalonate pathway, negative regulation of HMG-CoA reductase activityIMP, regulates phosphorylation of hmg1, annotation_extension=in_absence_of(CHEBI:16646) (sugar)
ppe1positive regulation of the mevalonate pathway, positivr regulation of HMG-CoA reductase activityIMP, regulates dephosphorylation of hmg1, annotation_extension=in presence of sugar / during cell growth

pmp1abolished enzymatic activityallele=C158S
pmp1abolished enzymatic activityannotation_extension=in_presence_of(CHEBI:35607) a tyrosine phosphatase inhibitor
DBLCHECKmight be more appropriate with response to metal rather than salt stressgo back and look when have time
deletion ppb1|overexpression pmp1suppresses salt stress sensitivity
deletion pmp1|expression of const. active ppb1deltaC (C-term truncated)suppresses salt stress sensitivity
deletion pmp1|expression of const. active ppb1deltaC (C-term truncated)suppresses FK506 sensitivity
deletion pmp1|expression of ppb1 overexpressedsensitive to salt stress and FK506
deletion pmp1|deletion ppb1|deletion pmk1normal cell growth
deletion ppb1|deletionpmk1filamentous and multiseptateallele=deletion
deletion ppb1|overexpression pmp1normal morphology

pka1there is an existing annotation to negative regulation of transcription by this git6?

-MF misfolded glycoprotein bindingIDA
-ph normal enzymatic activity (normal GO:0000224 activity)allele=ΔH1(del_aa1-15)
-ph abolished enzymatic activity. (abolished GO:0000224 activity)allele=ΔH1ΔH2(del_aa1-38)
-ph abolished protein bindingallele=ΔH1(del_aa1-15)

ofd2abolished oxidoreductase/enzyme activityallele=H132A,ODA

drc1normal protein bindinghas_substrate(cdc2),allele=CD5A(T154A,T99A,T74A,T60A,S87A)
drc1abolished protein binding/interaction with Cut5allele=CD5A(T154A,T99A,T74A,T60A,S87A)

cbf11binds GTGGGAACSL response element, term requested from SO

stm1upregulated mRNA during nitrogen starvationIDA
stm1early G1 arrest in response to nitrogen starvationallele=deletion,ODA
stm1|ras1absence of G1 arrest in response to nitrogen starvationallele+deletion (both) ODA
stm1|ras1slow cell growth in minimal media containing ammonia nitrogen sourceallele=deletion (both) cell growth assay
stm1|gpa2normal cell growth in minimal media containing ammonia nitrogen sourceannotation_extension=condition(overexpression - stm1)allele=deletion (gpa2) cell growth assay
stm1|gpa2normal septationannotation_extension=condition(overexpression - stm1)allele=deletion (gpa2) cell growth assay
stm1abolished protein binding (gpa2)allele=K199AODA

scd1abnormal cellular response to starvationallele=deletion, cell growth assay
scd2abnormal cellular response to starvationallele=deletion, cell growth assay

mag1reduced enzymatic activity/DNA-1,N6-ethenoadenine N-glycosylase activity/DNA-7-methylguanine glycosylase activityallele=D170N(D170N)
mag1reduced enzymatic activity/DNA-1,N6-ethenoadenine N-glycosylase activityallele=S172G(S172G)
mag1normal enzymatic activity/DNA-1,N6-ethenoadenine N-glycosylase activity/DNA-7-methylguanine glycosylase activityallele=F158S,S159G(F158S,S159G)
mag1structure PDB ID 3S61according to authors, does not appear to match however
mag1reduced enzymatic activity/DNA-1,N6-ethenoadenine N-glycosylase activityallele=Q62A,L63A(Q62A,L63A)
mag1abolished enzymatic activity/DNA-7-methylguanine glycosylase activityallele=Q62A,L63A(Q62A,L63A)
mag1increased enzymatic activity/DNA-1,N6-ethenoadenine N-glycosylase activityallele=H64S(H64S)
mag1normal enzymatic activity/DNA-7-methylguanine glycosylase activityallele=H64S(H64S)

pyp2552 bp 5' UTR
pyp1|pyp2inviable germinating sporeallele=deletion (both)
pyp1 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_normal_temperature)
pyp2 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_normal_temperature)
pyp1 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_high_temperature)
pyp2 cdc25cell cycle arrestannotation_extension=condition(overexpression, pyp1), allele=cdc25-22, anotation_extension=condition(at_high_temperature)
pyp1 cdc2normal cell length (cell division/cell cycle)annotation_extension=condition(overexpression, pyp1), allele=cdc2-1w
pyp2 cdc2normal cell length (cell division/cell cycle)annotation_extension=condition(overexpression, pyp1), allele=cdc2-1w
pyp1 wee1elongated cellsannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_normal_temperature)
pyp2 wee1elongated cellsannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_normal_temperature)
pyp1 wee1normal cell length (possibly could use normal cell growth or normal cell division/mitotic cell cycleannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_high_temperature)
pyp2 wee1normal cell length (possibly could use normal cell growth or normal cell division/mitotic cell cycleannotation_extension=condition(overexpression, pyp1), allele=wee1-50, anotation_extension=condition(at_high_temperature)
pyp1 cdc25normal cell lengthallele=deletion, pyp1), allele=cdc25-22, annotation_extension=condition(at_normal_temperature)
pyp2 cdc25elongated cellsallele=deletion, pyp1), allele=cdc25-22, annotation_extension=condition(at_normal_temperature)
pyp1 cdc25elongated cellsallele=deletion, pyp1), allele=cdc25-22, annotation_extension=condition(at_high_temperature)

gnr1increased sensitivity to pheromone/increased maximum efficacy of responseallele=deletion
gnr1decresed sensitivity to pheromone/increased maximum efficacy of responseannotation_extension=condition(overexpression)
git5normal sensitivity to pheromone/increased maximum efficacy of responseallele=deletion
git5decresed sensitivity to pheromone/increased maximum efficacy of responseannotation_extension=condition(overexpression)

pmd1sensitive to leptomycin Ballele=deletion
pmd1sensitive to Valinomycinallele=deletion
pmd1sensitive to K-252aallele=deletion
pmd1sensitive to Actinomycin Dallele=deletion

fas2normal fatty acid synthesis activityallele=H201(I1276T),annotation_extension=condition(at_normal_temperature)
fas2normal fatty acid synthesis activityallele=H265(Q4Y),annotation_extension=condition(at_normal_temperature)
fas2normal fatty acid synthesis activityallele=H518(I600N),annotation_extension=condition(at_normal_temperature)
fas2abnormal fatty acid synthesis activityallele=H201(I1276T),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H265(Q4Y),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=condition(at_high_temperature)
fas2normal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:15756),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:30805),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:28875),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:42504),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:32365),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:28842),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:28194),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:16196),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:36023),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:17351),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:25048),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:28822),annotation_extension=condition(at_high_temperature)
fas2abnormal fatty acid synthesis activityallele=H518(I600N),annotation_extension=in_presence_of(CHEBI:31003),annotation_extension=condition(at_high_temperature)
fas2increased accumulation of see belowallele=H201(I1276T),annotation_extension=condition(at_high_temperature)
fas2increased accumulation of see belowallele=H265(Q4Y),annotation_extension=condition(at_high_temperature)
fas2increased accumulation of see belowallele=H518(I600N),annotation_extension=condition(at_high_temperature)
fas2decreased accumulation of see belowallele=H201(I1276T),annotation_extension=condition(at_high_temperature)
fas2decreased accumulation of see belowallele=H265(Q4Y),annotation_extension=condition(at_high_temperature)
fas2decreased accumulation of see belowallele=H518(I600N),annotation_extension=condition(at_high_temperature)

For the 3 mutants above:
increased accumulation of at high temp: N-monomethyldioleoyl-PE (N-monomethyl-C18:1-C18:1-PE) N,N-dimethyl-C18:1-C18:1-PE N,N-monomethyl-C18:1-C18:1-PE N,N-dimethyl-C16:1-C18:1-PE 1-melissoyl-oleolyl-sn-glycero-3-phosphoethanolamine (C30:0-C18:1-PE) 1-melissoyl-2-oleolyl-sn-glycero-3-phosphocholine (C30:0-C18:1-PC) CHEBI:16337 CHEBI:36711

decreased accumulation of at high temp: (NOT in mutant 518) 1-oleolyl-2-caproyl-sn-glycero-3-phosphocholine (C18:1-C10:0-PC) C18:0-C10:0-PC C18:0-C8:0-PC CHEBI:18303 CHEBI:17517

pdf1annotated inviable germinating spore but should it really be inviable spore?allele=deletion
pdf1sensitive to sodium orthovanadateallele=S106A(S106A)
pdf1sensitive to sodium orthovanadateallele=D226A(D226A)
pdf1sensitive to 'near alkaline/high' pH (=condition?)allele=S106A(S106A)
pdf1sensitive to 'near alkaline/high' pH (=condition?)allele=D226A(D226A)
pdf1dbl mutant normal growth in presence of sodium orthovanadateallele=S106A(S106A),allele=H478A(H478A) (2 plasmids)
pdf1dbl mutant normal growth in presence of sodium orthovanadateallele=D226A(D226A),allele=H478A(H478A) (2 plasmids)
pdf1dbl mutant normal growth in presence of 'near alkaline/high' pH (=condition?)allele=S106A(S106A),allele=H478A(H478A) (2 plasmids)
pdf1dbl mutant normal growth in presence of 'near alkaline/high' pH (=condition?)allele=D226A(D226A),allele=H478A(H478A) (2 plasmids)

gcs1 + ade6sensitive to cadmiumallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6sensitive to cadmiumallele=deletion,allele=ade6-210(unknown))
gcs1 + ade6normal growth in presence of either ions: Ca|Na|Mgallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6normal cell growthannotation_extension=condition(in_rich_media),allele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6resistant to MNNG (N-methyl-N'-nitro-N-nitrosoguanidine)allele=deletion,allele=ade6-210(unknown))|
gcs1 + ade6slow cell growthannotation_extension=condition(in_minimal_media),allele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6slow cell growthannotation_extension=condition(in_minimal_media),allele=deletion,allele=ade6-210(unknown)
gsh2 + ade6slow cell growthannotation_extension=condition(in_minimal_media),allele=deletion,allele=ade6-210(unknown)
hmt1 + ade6normal cell growthannotation_extension=condition(in_minimal_media),allele=deletion,allele=ade6-210(unknown)
gcs1 + ade6normal cell growthannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6normal cell growthannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=deletion,allele=ade6-210(unknown)
gsh2 + ade6normal cell growthannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=deletion,allele=ade6-210(unknown)
gcs1 + ade6sporulation abolishedallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6normal sporulationannotation_extension=in_presence_of(CHEBI:16856),allele=apd1-1(unknown),allele=ade6-210(unknown)
ade6red pigmentation of coloniesallele=ade6-210(unknown)
hmt1 + ade6red pigmentation of coloniesallele=deletion,allele=ade6-210(unknown)
gcs1 + ade6absent/reduced red pigmentation of coloniesallele=apd1-1(unknown),allele=ade6-210(unknown)
gcs1 + ade6absent/reduced red pigmentation of coloniesallele=deletion,allele=ade6-210(unknown)
gsh2 + ade6reduced red pigmentation of coloniesallele=deletion,allele=ade6-210(unknown)
gcs1 + ade6absent/reduced red pigmentation of coloniesannotation_extension=condition(in_minimal_media),annotation_extension=in_presence_of(CHEBI:16856),allele=apd1-1(unknown),allele=ade6-210(unknown)
ade6reduced red pigmentation of coloniesannotation_extension=in_presence_of(CHEBI:46442),allele=ade6-210(unknown)

arc3inviable spore or inviable germinating spore? wait to hear from Jackyallele=deletion
arc3complementation study with human arc3...capture?

vps34BP - requested a child of GO:0046854

ade2/ade6dbl mutant sensitive to cadmiumallele=ade6-216,allele=ade2(unknown)

gsa1part of glutathione synthase complex GO:0036087IDA

adenylosuccinate synthase activity has_sub(cysteine sulfinate - chebi requested)IDA