Changes between Version 360 and Version 361 of CuratorTrainingPapers


Ignore:
Timestamp:
Nov 9, 2011, 12:11:07 PM (10 years ago)
Author:
antonialock
Comment:

--

Legend:

Unmodified
Added
Removed
Modified
  • CuratorTrainingPapers

    v360 v361  
    11= Papers = [[BR]]
    22[wiki:PapersWithNoID Papers with no PMID] [[BR]]
    3 [wiki:PayToView Papers costing ££ to access]
    4 [wiki:AntoniasCuratedPapers Antonias curated papers]
     3[wiki:PayToView Papers costing ££ to access] [[BR]]
     4[wiki:AntoniasCuratedPapers Antonias annotations that are not in yet]
    55
    66[[BR]]
     
    211211[[BR]]
    212212= Annotations yet to be implemented =
    213 
    214 [[BR]]
    215 ||21727087||Antonia||
    216 || gene|| term || extension||
    217 || ppr3|| regulation if mitochondrial rRNA stability || annotation_extension=substrate_is((GeneDB_Spombe:SPRRNA.02||
    218 ||dmr1 (ppr3)||mitochondrial translation phenotype, less translation of mt proteins||allele=deletion||
    219 ||ppr6||sensitive to growth on G418/geneticin||allele=deletion||
    220 ||ppr7||sensitive to growth on G418/geneticin||allele=deletion||
    221 ||ppr5||enhanced growth on glucose||allele=deletion||
    222 
    223 
    224 [[BR]]
    225 ||21745468||Antonia||
    226 || gene|| term || extension||
    227 ||lkh1||expression||upregulated during mitosis and cytokinesis (=mitotic cell cycle) (IDA)||
    228 ||lkh1, dsk1||((phenotype)) severe growth defect (cell growth assay)||allele=Δdsk1Δlkh1||
    229 
    230 [[BR]]
    231 ||17369611||Antonia||
    232 ||gene|| term || extension||
    233 ||rtt109||Delta rtt109/Histone H3 K56R double-mutant phenotype||asynthetic sensitivity to DNA damage||
    234 
    235 [[BR]]
    236 ||9191268||Antonia||
    237 ||gene|| term || extension||
    238 ||mam1||||annotation_extension= '''does not''' ...||
    239 ||mam1||how to capture transcription increased to nitrogen starvation?||||
    240 ||mam1||how to capture transcription increased in response to pheromone?||||
    241 
    242 [[BR]]
    243 ||17248713||Antonia||
    244 ||gene|| term || extension||
    245 ||map1|| ||expression suppressed in 2674. annotation_extension=''' doesnot '''occurs_in(CL:0002674 (but does occur in 2675)||
    246 
    247 [[BR]]
    248 ||2792737||Antonia||
    249 ||gene|| term || extension||
    250 ||mat1-Pc||constitutively expressed (how to capture expression pattern?)||annotation_extension=occurs_in(CL:0002675)||
    251 ||mat1-Pc||Upregulated in response to nitrogen starvation (how to capture expression pattern?)||annotation_extension=occurs_in(CL:0002675)||
    252 ||mat1-Pi||Expressed in response to nitrogen starvation (how to capture expression pattern?)||annotation_extension=occurs_in(CL:0002675)||
    253 ||map1||regulation of transcription, mating-type specific||annotation_extension=occurs_in(CL:0002675)||
    254 ||map1||transcription regulation phenotype||add to annotation extension condition/during=nitrogen_starvation 2 annotations for this (2 targets, pi and pc)||
    255 ||map1||transcription regulation phenotype||add to annotation extension that transcription is downregulated (2 targets, pi and pc)||
    256 ||map1||abnormal '''premeiotic''' DNA replication initiation||allele=deletion||
    257 
    258 [[BR]]
    259 ||2900761||Antonia||
    260 ||gene|| term || extension||
    261 ||mat2-P...or mat2-Pc/Pi||Silenced (waiting for GeneDB to update cassette info so this can be annotated)||IMP mat1-||
    262 ||mat3-M...or mat3-Mc/Mi||Silenced (waiting for GeneDB to update cassette info so this can be annotated)||IMP mat1-||
    263 ||mat1-Mi||Phenotype: can conjugate but not undergo meiosis/sporulate||allele=Mifs15(del_nt43-129)||
    264 ||mat1-Pi||Phenotype: can conjugate but not undergo meiosis/sporulate||allele=Piop7(del_nt19-357)||
    265 ||mat1-Pc||Phenotype: can't conjugate||allele=Pcop5(del_nt17-480)||
    266 ||mat1-Mc||Phenotype: can't conjugate||allele=Mcop7(del_nt19-546)||
    267 ||mat1-Pc||severe reduction in spore formation||allele=deletion||
    268 ||mat1-Pc||process: required for efficient meiosis||IMP, allele=deletion||
    269 ||mat1-Mc||process: required for efficient meiosis||IMP, allele=deletion||
    270 
    271 ||mat1-Pc||expression: constitutively expressed (low levels) (rich media)||IMP, allele=SP272(h+/h- meiotically competent diploid)||
    272 ||mat1-Pc||expression: constitutively expressed (low levels) (rich media)||IMP, allele=SP720(fus1 deletion...capture as WT?)||
    273 ||mat1-Mc||expression: constitutively expressed (low levels) (rich media)||IMP, allele=SP272(h+/h- meiotically competent diploid)||
    274 ||mat1-Mc||expression: constitutively expressed (low levels) (rich media)||IMP, allele=SP720(fus1 deletion...capture as WT?)||
    275 ||mat1-Pi||expression: not expressed (rich media)||IMP, allele=SP272(h+/h- meiotically competent diploid)||
    276 ||mat1-Pi||expression: not expressed (rich media)||IMP, allele=SP720(fus1 deletion...capture as WT?)||
    277 ||mat1-Mi||expression: not expressed (rich media)||IMP, allele=SP272(h+/h- meiotically competent diploid)||
    278 ||mat1-Mi||expression: not expressed (rich media)||IMP, allele=SP720(fus1 deletion...capture as WT?)||
    279 ||All 4 are upregulated in response to nitrogen starvation. In diploid; downregulation at 6h compared to 4h, in haploid; no downregulation||
    280 
    281 [[BR]]
    282 ||2328719||Antonia||
    283 ||gene||term || extension||
    284 ||map1||transcription phenotype, target is not upregulated in response to nitrogen starvation||allele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:'''mat1-PC''',(strain is H90))||
    285 ||mat1-Pc||positive autoregulation of transcription in response to nitrogen starvation||allele=mat1-Pc-161()||
    286 ||map1||transcription phenotype, target is not expressed in response to nitrogen starvation||allele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:'''mat1-Pm''',(strain is H90))||
    287 ||mat1-Pc||transcription phenotype, target is not expressed in response to nitrogen starvation||allele=mat1-Pc-161(),annotation_extension=has_regulation_target(GeneDB_Spombe:'''mat1-Pm''',(strain is H90))||
    288 ||mat1-Pc||low constitutive expression in rich media||allele=H90(fus1 deletion)||
    289 ||mat1-Pm||no constitutive expression in rich media||allele=H90(fus1 deletion)||
    290 ||mat1-Pm||expression in response to nitrogen starvation is dependent on the presence of CL:0002674||annotation_extension=occurs_in(CL:0002675)||
    291 ||mat1-Pc||upregulation in response to nitrogen starvation is '''not''' dependent on the presence of CL:0002674||annotation_extension=occurs_in(CL:0002675)||
    292 ||ran1||process: negative regulation of transcription from RNA polymerase II promoter during mitosis (IMP evidence code)||allele=pat1-114,annotation_extension=has_regulation_target(GeneDB_Spombe:'''mat1-Pm, mat1-Mc and Mat1-Pc'''
    293 
    294 [[BR]]
    295 ||10438147||Antonia||
    296 ||gene||term||extension||
    297 ||gaf1||experiments were performed in Sc. cerevisiae, but investigating pombe proteins||||
    298 ||gaf1||number of tas etc annotations for gene that can probably be removed once update is done||||
    299 ||gaf1||RNA polymerase II core promoter proximal region sequence-specific DNA binding||has substrate GATA boxes (requested term from SO SO:0001840)||
    300 ||gaf1||phenotype: has DNA binding activity||allele=Gaf1N(AA1-120)||
    301 ||gaf1||phenotype: abolished DNA binding activity||allele=GAF1C(121-290)||
    302 
    303 [[BR]]
    304 ||17452352||Antonia||
    305 ||gene||term||extension||
    306 ||ams2||expression oscillates during cell cycle, peaks at S-phase (except hht2 which remain constant)||
    307 ||ams2||delayed septation||allele=deletion||
    308 ||ams2||DNA replication appears normal||allele=deletion||
    309 ||ams2||RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription||add extension: annotation_extension=acts_at(SO: GATA transcr factor - term is requested)||
    310 ||ams2 + hht2||synthetic lethality, double mutant||allele=deletion||
    311 ||sequence feature|| annotate AACCCT as a GATA transcription factor binding site, seq 5'-ATCA(C/A)AACCCTAACCCT-3'||artemis?||
    312 ||ams2||CC nuclear chromosome||acts at(SO:GATA transcr factor binding site||
    313 
    314 [[BR]]
    315 ||18077559|Antonia||
    316 ||gene||term||expression||
    317 ||ams2 hip1||slow cell growth||allele=dbl mutant||
    318 
    319 
    320 [[BR]]
    321 ||20230746||Antonia||
    322 ||gene||term||extension||
    323 ||ams2|| remove NAS and TAS from artemis||||
    324 ||ams2||protein is unstable during G2 and M phase, partially stable during G1 and stable during S||
    325 ||ams2||protein stability: is stable during S phase, level increased||||
    326 ||ams2||protein stability: is unstable during G2 phase, level decreased OR possibly only synthesised during S phase?||||
    327 ||ams2||protein stability: is unstable during G1/M phase, level increased OR possibly only synthesised during S phase?||||
    328 ||ams2||protein stability: is degraded by the SCF ubiquitin ligase pathway||||
    329 ||ams2||allele=overexpression(overexpression and allele=deletion(deletion)...correct way of writing this is?||||
    330 
    331 [[BR]]
    332 ||18158900||Antonia||
    333 ||sim3||phenotype: abnormal chromatin silencing at centromere|abnormal at kinetochore(central core/cnt)||allele=143(G81E),allele=205(E207K)||
    334 ||sim3||phenotype: inviable at 18 degrees, inhibited growth at 25/32/36 degrees||allele=deletion||
    335 ||double mutant||sim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed cnp1 = normal phenotype||||
    336 ||double mutant||sim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H4 = normal phenotype||||
    337 ||double mutant||sim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H3 = reduced viability (inviable ok)||||
    338 ||sim3||go biological process: protein localization to kinetochore||annotation_extension=does not happens_during G1||
    339 
    340 [[BR]]
    341 
    342 ||cnb1,ppb1||dbl deletion mutant same phenotype as each single mutant (branched,elongated multi-septate cells + slow growth in presence of mgcl2||worth annotating? i.e. shows may be linked perhaps? dbl mutant not more severe||
    343 ||cnb1,ppb1,pmp1||dbl del + overexpressed = normal cell growth||||
    344 ||cnb1,ppb1||deletion,overexpr. slow growth in presence of mgcl2||i.e. large amounts of catalytic domain is not functional without regulatory subunit. is this interesting to capture?||
    345 ||cnb1,ppb1∆C(L445->STOP||deletion,overexpressed. slow growth in presence of mgcl2||constitutively active mutant is not active without regulatory subunit||
    346 ||cnb1,ppb1∆C(L445->STOP||overexpressed,overexpressed. phenotype growth arrest, round small bent pear-shaped cells. depolarized distr of cortical F-actin patches||normal phenotype in presence of CHEBI:61049||
    347 ||cnb1,ppb1∆C(L445->STOP,prz1||overexpressed,overexpressed, deleted. no growth arrest||||
    348 
    349 [[BR]]
    350 ||16928959||Antonia||
    351 ||∆yam8||not involved in calcium response in presence of cacl2 or chlorpromazine||IMP - phenotype decreased cellular signalling?||
    352 ||∆cch1||not involved in calcium response in presence of cacl2 or chlorpromazine||IMP||
    353 
    354 [[BR]]
    355 ||20018864||Antonia||
    356 ||gene||term||extension||
    357 ||ncs1||expression:upregulated in response to CHEBI:29108 NOT upregulated in response to CHEBI:6636, CHEBI:26710, CHEBI:32588, CHEBI:30911, CHEBI:32035, or CHEBI:61049||IDA||
    358 ||deletion(prz1), overexpression(ncs1)||slow growth||cell growth assay||
    359 ||deletion(ncs1), overexpression(prz1)||slow growth||cell growth assay||
    360 ||deletion(prz1), overexpression(ncs1)||inviable in_response_to(CHEBI:29108)||IMP||
    361 ||deletion(ncs1), overexpression(prz1)||inviable in_response_to(CHEBI:29108)||IMP||
    362 ||deletion(ncs1),deletion(yam8)||normal cell growth in_presence_of(CHEBI:33120||cell growth assay||
    363 ||ncs1||promoter region lies in -1-130 region caact esp important||||
    364 ||ncs1||promoter for upregulation in response to calcium lies in -101-130 region||||
    365 ||ncs1||promoter for basal expression lies in -1-130 region||||
    366 ||prz1||binds caact in promoter region of ncs1||||
    367 
    368 [[BR]]
    369 ||14722091||Antonia||
    370 ||gene||term||extension||
    371 ||ncs1||upregulated in response to CaCl2+||||
    372 
    373 [[BR]]
    374 ||18362178||Antonia||
    375 ||gene||term||extension||
    376 ||acr1||phenotype:ringlike nuclear chromatin||allele=acr1-936, requested term||
    377 ||nuc1||phenotype:ringlike nuclear chromatin||allele=nuc1-632, requested term||
    378 ||cut14||phenotype=abnormal nucleolar rDNA separation||allele=cut14-208,qualifier=at_high_temperature||
    379 
    380 
    381 [[BR]]
    382 ||21879336||Antonia||
    383 ||rst2||in a ∆pka1 mutant and sam5 and sam7 rst2 is phosphorylated under normal conditions (not in wt)||||
    384 ||pka1||normal protein localization||||
    385 ||pka1||normal protein localization||annotation_extension=exists_during:GO:0042149)||
    386 
    387 [[BR]]
    388 ||19606215||Antonia||
    389 ||cnx1||dbl mutant phenotype: abnormal cell wall morphology||allele=lumenal_cnx1p(aa_del488-560),allele=C-termTM_Cnx1p_cmyc(aa_del1-415)||
    390 ||cnx1||some confusing data regarding apoptosis. Notes in hardcopy paper||allele=lumenal_cnx1p(aa_del488-560)||
    391 ||cnx1||allele specifications may not be 100% correct||||
    392 
    393 
    394 [[BR]]
    395 ||18621924||Antonia||
    396 ||cyr1,cgs1 dbl deletion||nuclear export abolished||allele=deletion,annotation_extension=localizes(GeneDBSpombe:SPBC106.10)||
    397 ||cgs||change annotation concerning localized to nucleus during GO:0009651 to nucleus excluding nucleolus||waiting to see if GO will give a term for this cellular component||
    398 
    399 [[BR]]
    400 ||12557273||Antonia||
    401 ||pik3-/pik3-||spore germination abolished, abnormal spore morphology||if a more specified term is added to CL then change CL:0000415 to homozygous diploid, if not then add allele=homozygous?||
    402 ||pik3-/pik3+||FYPO:0000579 normal spore germination||add this with either CL:0000415 + allele=heterozygous or more specific CL if given||
    403 ||pik3||have requested 2 process terms from GO (+ve regulation of protein targeting to prospore/vacuolar membrane||update if granted||
    404 ||pik3||abnormal protein targeting to prospore membrane phenotype||allele=deletion,annotation_extension=localizes(PF:01363)||
    405 
    406 [[BR]]
    407 ||9191269||Antonia||
    408 ||plc1||qualifier in genedb for binding:"N-term", not clear if it binds N-term or if it binds via N-term"
    409 
    410 [[BR]]
    411 ||9191271||Antonia||
    412 ||matPi||mRNA levels increase in response to M-factor||occurs_in(CL:0002675||
    413 
    414 [[BR]]
    415 ||9388669||Antonia||
    416 ||krp1||abolished enzymatic activity||allele=R82A, qualifier=in_vitro||
    417 
    418 [[BR]]
    419 ||10792724||Antonia||
    420 ||sxa2||Normal carboxypeptidase activity||K309A||
    421 ||sxa2||Normal carboxypeptidase activity||K309A,R310K||
    422 ||sxa2||No carboxypeptidase activity||K309A,R310A||
    423 ||sxa2||No carboxypeptidase activity||S460*(delS460-Y507)||
    424 ||sxa2||No carboxypeptidase activity||563(W247->amber||
    425 ||sxa1||remove the artemis annotation to BP conjugation with cellular fusion||||
    426 
    427 [[BR]]
    428 ||map3/mam2||diploid strain (CL:0000415) cannot sporulate if both receptors expressed at the same time||||
    429 
    430 [[BR]]
    431 ||1563351||Antonia||
    432 ||MatPi||expressed in response to nitrogen starvation and M factor in Pcells||IDA||
    433 ||ste6||MatPi not expressed during N starvation and in presence of M factor in P cells||allele=deletion||
    434 ||ras1||MatPi not expressed during N starvation and in presence of M factor in P cells||allele=deletion||
    435 ||ras1||MatPi expressed during N starvation and in presence of M factor in P cells, not constitutively expressed||allele=ras1val17||
    436 ||pat1/ras1||mat1-Pm transcribed||allele=pat1-114/deletion, at high temp||
    437 ||pat1/ste6||mat1-Pm transcribed||allele=pat1-114/deletion, at high temp||
    438 
    439 ||8196631||Antonia||
    440 ||mfm1/mfm2||FYPO:0000584 decreased sporulation||allele=deletion (both)||
    441 ||mfm1/mfm3||FYPO:0000584 decreased sporulation||allele=deletion (both)||
    442 ||mfm2/mfm3||FYPO:0000584 decreased sporulation||allele=deletion (both)||
    443 ||mfm1/mfm2/mfm3||FYPO:0000583 sporulation abolished||allele=deletion (all 3)||
    444 ||mfm1/mfm2/mfm3||FYPO:0000583 sporulation abolished||allele=deletion (all 3),annotation_extension=in_presence_of(M-factor - externally added),annotation_extension=occurs_in:CL0002674||
    445 ||mfm1/mfm2/mfm3||FYPO:0000590 normal sporulation||allele=deletion (all 3),annotation_extension=occurs_in:CL0002674||
    446 ||mfm1||expressed in CL:0002674||happens during(GO:0006995) - cellular response to nitrogen starvation||
    447 ||mfm2||expressed in CL:0002674||happens_during(GO:0000278) - mitotic cell cycle||
    448 ||mfm2||expression increased in CL:0002674||happens during(GO:0006995) - cellular response to nitrogen starvation||
    449 ||mfm3||expressed in CL:0002674||happens during(GO:0006995) - cellular response to nitrogen starvation||
    450 ||mfm1||not expressed in CL:0002675||||
    451 ||mfm2||not expressed in CL:0002675||||
    452 ||mfm3||not expressed in CL:0002675||||
    453 ||mfm1||expression increased||annotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation||
    454 ||mfm2||expression increased||annotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation||
    455 ||mfm3||expression increased||annotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation||
    456 
    457 [[BR]]
    458 ||154790||Antonia||
    459 ||mfm1/2/3||Add on gene page that the final peptide gene product is 9 amino acids long and consists of YTPKVPYM||||
    460 
    461 [[BR]]
    462 ||7975894||Antonia||
    463 ||gpa1||phenotype: increased expression of MatPi during nitrogen starvation; constitutively active. Pheromone doesn't influence transcription||Q244L||
    464 ||ras1||phenotype: increased expression of Matpi during nitrogen starvation in the presence of pheromone||G17V||
    465 ||mat1Pm/pi||promoter element mapped in paper -61- -41 (ccctctttctttgttccttat||||
    466 
    467 [[BR]]
    468 ||7813430||Antonia||
    469 ||krp1||expressed in mitotically growing cells||||
    470 ||krp1||expressed in response to nitrogen starvation||||
    471 ||krp1||dibasic endopeptidase activity - have one for serine peptidase activity, use that one?||need to request term||
    472 
    473 [[BR]]
    474 ||8314086||Antonia||
    475 ||sxa2||expressed in presence of p-factor||||
    476 ||map2||expressed in H- cells||||
    477 ||cyr1/sxa2||phenotype G1 arrest in presence of P-factor in rich media||allele=deletion||
    478 ||cyr1/sxa2||abnormal/increased shmoo formation in presence of P-factor in rich media||allele=deletion||
    479 
    480 [[BR]]
    481 ||18059475||Antonia||
    482 ||fkh2||reduced zygote formation||allele=deletion||
    483 ||fhl1||reduced zygote formation||allele=deletion||
    484 ||mei4||reduced zygote formation||allele=deletion||
    485 ||fkh2/fhl1||reduced zygote formation||allele=deletion||
    486 ||fkh2/mei4||reduced zygote formation||allele=deletion||
    487 ||fkh2/fhl1/mei4||reduced zygote formation||allele=deletion||
    488 ||ste11||annotate promoter proximal element FLEX1 and FLEXL1 to ste11, artemis||||
    489 ||fkh2||reduced zygote formation||allele=T314E||
    490 ||fkh2||reduced zygote formation||allele=S462E||
    491 ||fkh2||normal zygote formation||allele=S481E||
    492 ||fkh2||reduced zygote formation||allele=T314E,S462E,S481E||
    493 ||fkh2||normal zygote formation||allele=T314A,S462A,S481A||
    494 ||fkh2||normal cell morphology||allele=T314E||
    495 ||fkh2||normal cell morphology||allele=S462E||
    496 ||cig2||increased rate of zygote formation||allele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)||
    497 ||cig2/fkh2||increased zygote formation||allele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)||
    498 ||cig2/fkh2/fhl1||reduced zygote formation||allele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)||
    499 ||cig2/fkh2/mei4||reduced zygote formation||allele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)||
    500 ||cig2/fkh2/fhl1/mei4||reduced zygote formation||allele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)||
    501 
    502 [[BR]]
    503 ||7651414||Antonia||
    504 ||mat1||have annotated M specific genes to the genes closest to the centromere (around 2120000). eg mat3m, matmc_2 NOT mat1-m or matmc_1. I think this is correct but dbl-check once artemis files are updated on genedb||
    505 ||mat1-mm)||expressed in response to P-factor and nitrogen starvation||IDA||
    506 ||mat1-pm||expressed in response to nitrogen starvation||IDA||
    507 
    508 [[BR]]
    509 ||10867006||Antonia||
    510 ||ste11||Unable to bind DNA region outside of the consensus motif||ste91||
    511 
    512 [[BR]]
    513 ||9418887||Antonia||
    514 ||krp1||abolished serine endopeptidase activity||allele=S371A ODA, qualifier=in_vitro||
    515 ||krp1||abolished serine endopeptidase activity||allele=K81I,R82A,R102K,S371A ODA, qualifier=in_vitro||
    516 ||krp1||abolished serine endopeptidase activity||allele=R82A ODA, qualifier=in_vitro||
    517 ||krp1||abolished serine endopeptidase activity||allele=K81I,R82A ODA, qualifier=in_vitro||
    518 ||krp1||normal serine endopeptidase activity||allele=R102K ODA, qualifier=in_vitro||
    519 ||krp1||abolished serine endopeptidase activity||allele=R82A,R102K ODA, qualifier=in_vitro||
    520 ||krp1||abolished serine endopeptidase activity||allele=I81I,R82AR102K ODA, qualifier=in_vitro||
    521 ||krp1||reduced serine endopeptidase activity||allele=R102A ODA, qualifier=in_vitro||
    522 ||krp1||reduced serine endopeptidase activity||allele=R82A,R102A ODA, qualifier=in_vitro||
    523 ||krp1||reduced serine endopeptidase activity||allele=K81I,R82A,R102A ODA, qualifier=in_vitro||
    524 ||krp1||abolished serine endopeptidase activity||allele=aa_del579-709 ODA, qualifier=in_vitro||
    525 ||krp1||abolished serine endopeptidase activity||allele=aa_del591-709 ODA, qualifier=in_vitro||
    526 ||krp1||normal serine endopeptidase activity||allele=aa_del612-709 ODA, qualifier=in_vitro||
    527 
    528 [[BR]]
    529 ||10931354||Antonia||
    530 ||krp1||no enzymatic activity (abolished serine endopeptidase activity)||allele=S271A ODA||
    531 ||krp1||normal enzymatic activity (normal serine endopeptidase activity)||allele=R102K ODA||
    532 ||krp1||normal enzymatic activity (normal serine endopeptidase activity)||allele=R82A ODA||
    533 ||krp1||no enzymatic activity (abolished serine endopeptidase activity)||allele=R82A,R102K ODA||
    534 ||krp1||normal enzymatic activity (normal serine endopeptidase activity)||allele=R82A,R102K,qualifier=overexpression ODA||
    535 ||krp1||no enzymatic activity (abolished serine endopeptidase activity)||allele=R102A ODA||
    536 ||krp1||normal enzymatic activity (normal serine endopeptidase activity)||allele=R102A,qualifier=overexpression ODA||
    537 ||krp1||no enzymatic activity (abolished serine endopeptidase activity)||allele=R82A,R102A ODA||
    538 ||krp1||normal enzymatic activity (normal serine endopeptidase activity)||allele=R82A,R102A,qualifier=overexpression ODA||
    539 ||krp1||no enzymatic activity (abolished serine endopeptidase activity)||allele=aa_del579-709 ODA||
    540 ||krp1||no enzymatic activity (abolished serine endopeptidase activity)||allele=aa_del591-709 ODA||
    541 
    542 [[BR]]
    543 ||15580593||Antonia||
    544 ||mam2||negative regulation of pheromone INDEPENDENT signal transduction. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)||||
    545 ||Mam2 mutants||phenotype: constitutively active (if term goes in||M cells||
    546 
    547 [[BR]]
    548 ||15659165||Antonia||
    549 ||mam2||negative regulation of pheromone INDEPENDENT signal transduction. Sequesters G alpha. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)||||
    550 ||Mam2P261L||phenotype: constitutively active (if term goes in||M cells||
    551 ||mam2||cellular component, homodimeric complex; will come under GO:0043235||IDA||
    552 ||mam2/gpa1||interaction evidence is wrong, but it's the best fit....should I not curate this? I think the evidence is pretty strong||||
    553 
    554 
    555 [[BR]]
    556 ||19285552||Antonia||
    557 ||rgs1||phenotype: increased sensitivity to pheromone||allele=deletion, in M cells||
    558 
    559 [[BR]]
    560 ||21118960||
    561 ||srw1||another phenotype: decreased cell cycle arrest in response to pheromone||allele=mutPste9(A->C and G-> T and vice versa throughout 27 bp reb1 binding region -198 - -172||
    562 ||srw1||decreased sporulation||mutPste9||
    563 ||srw1 ectopically expressed | reb1 deletion||normal cell cycle arrest in response to pheromone||phenotype||
    564 ||reb1|wee1||phenotype: slow growth at high temperature||allele=deletion(reb1)/wee1-50||
    565 ||reb1|wee1||phenotype: multiseptate (0000118)||allele=deletion(reb1)/wee1-50||
    566 ||reb1|wee1||phenotype: wee||allele=deletion(reb1)/wee1-50||
    567 ||reb1|wee1||phenotype: spheroid cells||allele=deletion(reb1)/wee1-50||
    568 ||reb1|wee1||phenotype: DNA content increased||allele=deletion(reb1)/wee1-50||
    569 ||reb1|wee1||phenotype: normal cell growth at high temperature||in_presence_of:CHEBI:44423, allele=deletion(reb1)/wee1-50||     
    570 ||reb1|cdc10||phenotype: slow growth at high temperature||allele=deletion(reb1)/cdc10-129||
    571 ||reb1|cdc10||phenotype: abnormal? cell cycle arrest||qualifier=at_high_temperature,allele=deletion(reb1)/cdc10-129||
    572 ||reb1|| change cell cycle arrest in mitotic G1 phase to "increased rate of"||allele=overexpression||   
    573 
    574 
     213       
    575214[[BR]]
    576215||17875641||updates DONE as of 2011-08-22||