wiki:CuratorTrainingPapers

Version 359 (modified by antonialock, 10 years ago) (diff)

--

Papers =

Papers with no PMID
Papers costing ££ to access


Misc Papers


PMIDFirst/final AuthorStatusCuratorcommentssession
21253571-Val-I have added the name, updated the species distribution, and status of clr5 (in Artemis) and mailed Pfam to create a protein family entry for the conserved N-terminal domain
17875641Tsutsumi/Kuno?curated Midori-http://sloth.sysbiol.cam.ac.uk/test/curs/fec781c2e8599d7a
20622008Khorosjutina/Gustafsson?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/77bdec1cc4f8a9e5
20929775Yamagishi/Watanabe?curatedMidoripending FYPO term additions http://sloth.sysbiol.cam.ac.uk/test/curs/d4e73d1a93ec5860
2175631Nakamura-Kubo/Nakamura?in progress Val-http://sloth.sysbiol.cam.ac.uk/test/curs/4794f2ac68f1b5ba
21813639Ding/Forsburg?curatedMidoriall except multiple mutationshttp://sloth.sysbiol.cam.ac.uk/test/curs/db0ab2817f38d5f6
12791993Pardo/Nurse?uncurated---
17658285Colmenares/Moazed?uncurated---
16787941Krapp/Simanis?uncurated---
16864655Wu/Pollard?uncurated---
15857958Bimbo/Balasubramanian?uncurated---
15755919Mishra/Balasubramanian?uncurated---
21844224Kiely/Winston?in progressval--
21862693Buchheit/Burei?curatedvalcontacted by author.n/a updated in Artemis
21386897 Ren /Gould in progress val contacted by author
21880100 Hiraoko/Haraguchi? in progress val contacted by author
21273250 Labbe? ctr4/5 in progress val -
Saberianfar/Karagiannis?in progress val new gene characterisation
21949882Korvald/ in progress val new gene characterisation
21828039Beaudoin/Labbe?in progress val new gene characterisation
21976488Takeda/complete val cut8 created a session but not added annotations as need extensions, add i) an annotation to capture dimerization, ii) phenotype for abnomal protein localization (of proteasome) in ts allele cut8-566(S201P),iii) cholesterol binding (MF) (residue 1-217, iv trace previous paper which shows ubiquitnated residues are LYS10/11/13/22
16096059Takeda/Yanagida?in progress (proteasome binding res 1-72) cut8val--
20418666Takeda in progress includes cut 8 at stationary phase val--
21712547Hauf in progress val--
21151105Martienssen need to resolve species distribtion of CEN-P orthologs val--
21873461Maraia val--
21900849-pil1, Biogrid queryval--
21984208-hnt3, DONEvalneed to add decreased DNA binding activity for F34A-
21113731Martin-Garcia/Valdivieso?-val-
17137508Andersen/Hartmann?-Petersenin progressAntonia
19682301Paul/Kawamukai?uncuratedAntonia--
19584544Oowatari/Kawamukai?uncuratedAntonia--
12557273Onishi/Fukui?uncuratedAntonia-http://sloth.sysbiol.cam.ac.uk/test/curs/45b4bbb5f0235d01
21091378Andersen/Hartmann?-PetersenuncuratedAntonia--
20970342Asakawa/Haraguchi?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/011e491e
21725325Li/Cande?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/a3663cd38f1f2a12
21727087Kuhl/Bonnefoy?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/da671cd7
21745468Tang/Carr?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/64d2c81c
9191268Davey/Christensen?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/2b3b7ef23078576
2792737Fujioka/Shimoda?curatedAntonia-http://sloth.sysbiol.cam.ac.uk/test/curs/1cfea3361eac50c
2900761Kelly/Beach?in progressAntonia-http://sloth.sysbiol.cam.ac.uk/test/curs/e8c3b5736c2d1f56
17369611Xhemacle/Arcangioli?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/9b5edbe6f0efcb45
14722091Hamasaki-KatagiricuratedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/3b98520c5f6ca92f
21869531Gupta/Kawamukai?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/a6a51043db00c124/
21879336Gupta/Kawamukai?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/60d1480f79c0c05b
19606215Guerin/Rokeach?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/f3083f2895ecf659
18621924Matsuo/Marcus?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/3771247b8002271
7672243Stuart/Michell?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/72c2e89987736e3
8654750Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/aeb3d0063f6b810
8736868Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/224599b759ca656
8736869Powner/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/14f96251db4cbe9b
8879046Hughes/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/4c6458be418faa18
8879047Powner/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/9ff9e4a1410473cd
8879048Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/af1b2fb92c778beb
9191269Slaaby/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/52d277da6d0f8b4
9191270Watson/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/b9471202da214e59
9191271Davis/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/bb15399f563a39a8
9191272Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/d7ecd688fa54e0f
9191273Hughes/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/3cd4cea969e25e08
9191274Powner/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/64f7cb8bd028f4bf
9388669Powner/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/843228633c4b7012
9388670Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/7a0647a630a18f51
9388668Watson/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/176dcc6242e7abfe
9450029Watson/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/1ff5b9ffa8f643b
9450053Hughes/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/3a1ad75ead7f6d5f
10792724Ladds/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/a525406360ac556a
8380233Tanaka/Yamamoto?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/5586aa35c0a6802f
1563351Nielsen/Egel?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/17ddda6fd2aaf627
8196631Kjaerulff/Nielsen?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/4cf5f407a9f3d7f
154790DaveycuratedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/631cdfca46998f0
7975894Aono/Shimoda?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/f3a65af2138844d6
7813430Davey/Matthews?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/8ccb3c8f2d46fe8
8314086Imai/Yamamoto?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/1cfaa3add2d5fd87
9037770Christensen/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/b00a5065fbeb471
7900424Egel/Nielsen?uncuratedAntonialots of diploidshttp://sloth.sysbiol.cam.ac.uk/test/curs/b00a5065fbeb471
7651414Willer/Nielsen?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/24e9f1d9ea02f952
8861202Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/ce4cb6da2a1e760
9032282Imai/Yamamoto?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/8622e3e232348e8d
9236781Christensen/Nielsen?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/bb1e1e8de651f26
9559556Watson/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/e43ab58908bb095
9418887Powner/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/b6bfec3d1b81e412
10487925Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/787c309b6034127
10931354Davis/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/eb07f91aa716d2b2
11115118Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/fa909d739f78709c
10417652Watson/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/2ad41d1fab1e751c
9599405Ladds/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/4f75e98b55c64601
12172965Didmon/Davey?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/3d8e1af5e6b75514
15580593Goddard/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/285a46669a679913
15659165Ladds/Davey?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/1bdef2cd0551c52
19285552Smith/Ladds?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/c472825384eadfb0
21118960Rodríguez-Sánchez/Hernández?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/f372ba194a5d127c
2558974Hoffman/Winston?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/d9a59af610cff3eb
18059475Shimada/Murakami?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/5fd244fcaaf1c2fa
10438147Won/Yoo? curatedAntoniasome changes in secondary structure info not curated. Not sure if it's of interesthttp://sloth.sysbiol.cam.ac.uk/test/curs/ae55f5308b1fdb21
17248713Meade/Gutz?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/f033fde52b328f44
2328719Nielsen/Egel?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/d47046a87d5d426
1657593Kitamura/Shimoda?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/1065390df3fc736f
17452352Takayama/Takahashi?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/7d59277f413fd328
18077559Takayama/Takahashi?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/440ff0786082ec49
18411404Song/He?curatedAntoniacomplete, but put into Ensembl HTP pipelinhttp://sloth.sysbiol.cam.ac.uk/test/curs/a6e63b8188666eeb
20230746Takayama/Saitoh?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/1f8813e260d783d1
20604974Takayama/Toda?curatedAntoniadonehttp://sloth.sysbiol.cam.ac.uk/test/curs/95c8e050e4eb2cd
18158900Dunleavy/Allshire?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/e98e46c39b053293
15657058Sio/Kuno?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/3fbb994e3bfea4
16928959Deng/Kuno?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/9e9fe89a25f614dc
20018864Hamasaki-Katagiri/Ames?curatedAntoniaincompletehttp://sloth.sysbiol.cam.ac.uk/test/curs/eeccd430b89acffb
10867006van Beest/Clevers?doneAntoniaIncomplete - Not sure if more can be captured?http://sloth.sysbiol.cam.ac.uk/test/curs/465139f68bfd6a53
10923028Xiang/Aves?doneAntoniaSome info on mat1 region for future refhttp://sloth.sysbiol.cam.ac.uk/test/curs/70f0e3fc2a2cb939
18362178Nakazawa/Yanagida?curatedAntoniaremove annotations?http://sloth.sysbiol.cam.ac.uk/test/curs/42cf6801addc7e5
21680738Burg/Espenshade?-Antonia-http://sloth.sysbiol.cam.ac.uk/test/curs/af743f1eacf15fc


List of reference genome papers left


ste11First/final AuthorStatusCuratorcommentssession
21409593|
21307597|
20634885
20605454
19417542
19056896community curation
18422613
17927811
17289922
17137508
17046992
map1
9003326
12172965
8668157
fep1
17211681
18223116
19252122
19502236
19915076
20435771
21421748
21531205
gaf1
9714813
ams2
done
mbx1
18057023
20032302
21098635
21098641
matmc
done
prz1
done
fhl1
15777722 in progressMidoriTAS
mei4
21449049
21429938
21148298
20531409
19737749
18923505
18815595
17927811
17804800
16823445
16286472
16272747
16024772
sep1
21098641
21098635
20852022
19636559
18931041
18057023
17922236
17596184
17332498
16972065
16317047
15829570
15611619
kfh2
21098641
21098635
19758441
18923505
18815595
18057023
17332498
spp27
12490702


Annotations yet to be implemented


21727087Antonia
gene term extension
ppr3 regulation if mitochondrial rRNA stability annotation_extension=substrate_is((GeneDB_Spombe:SPRRNA.02
dmr1 (ppr3)mitochondrial translation phenotype, less translation of mt proteinsallele=deletion
ppr6sensitive to growth on G418/geneticinallele=deletion
ppr7sensitive to growth on G418/geneticinallele=deletion
ppr5enhanced growth on glucoseallele=deletion


21745468Antonia
gene term extension
lkh1expressionupregulated during mitosis and cytokinesis (=mitotic cell cycle) (IDA)
lkh1, dsk1((phenotype)) severe growth defect (cell growth assay)allele=Δdsk1Δlkh1


17369611Antonia
gene term extension
rtt109Delta rtt109/Histone H3 K56R double-mutant phenotypeasynthetic sensitivity to DNA damage


9191268Antonia
gene term extension
mam1annotation_extension= does not ...
mam1how to capture transcription increased to nitrogen starvation?
mam1how to capture transcription increased in response to pheromone?


17248713Antonia
gene term extension
map1 expression suppressed in 2674. annotation_extension= doesnot occurs_in(CL:0002674 (but does occur in 2675)


2792737Antonia
gene term extension
mat1-Pcconstitutively expressed (how to capture expression pattern?)annotation_extension=occurs_in(CL:0002675)
mat1-PcUpregulated in response to nitrogen starvation (how to capture expression pattern?)annotation_extension=occurs_in(CL:0002675)
mat1-PiExpressed in response to nitrogen starvation (how to capture expression pattern?)annotation_extension=occurs_in(CL:0002675)
map1regulation of transcription, mating-type specificannotation_extension=occurs_in(CL:0002675)
map1transcription regulation phenotypeadd to annotation extension condition/during=nitrogen_starvation 2 annotations for this (2 targets, pi and pc)
map1transcription regulation phenotypeadd to annotation extension that transcription is downregulated (2 targets, pi and pc)
map1abnormal premeiotic DNA replication initiationallele=deletion


2900761Antonia
gene term extension
mat2-P...or mat2-Pc/Pi?Silenced (waiting for GeneDB to update cassette info so this can be annotated)IMP mat1-
mat3-M...or mat3-Mc/Mi?Silenced (waiting for GeneDB to update cassette info so this can be annotated)IMP mat1-
mat1-MiPhenotype: can conjugate but not undergo meiosis/sporulateallele=Mifs15(del_nt43-129)
mat1-PiPhenotype: can conjugate but not undergo meiosis/sporulateallele=Piop7(del_nt19-357)
mat1-PcPhenotype: can't conjugateallele=Pcop5(del_nt17-480)
mat1-McPhenotype: can't conjugateallele=Mcop7(del_nt19-546)
mat1-Pcsevere reduction in spore formationallele=deletion
mat1-Pcprocess: required for efficient meiosisIMP, allele=deletion
mat1-Mcprocess: required for efficient meiosisIMP, allele=deletion
mat1-Pcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Pcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Mcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Mcexpression: constitutively expressed (low levels) (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Piexpression: not expressed (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Piexpression: not expressed (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
mat1-Miexpression: not expressed (rich media)IMP, allele=SP272(h+/h- meiotically competent diploid)
mat1-Miexpression: not expressed (rich media)IMP, allele=SP720(fus1 deletion...capture as WT?)
All 4 are upregulated in response to nitrogen starvation. In diploid; downregulation at 6h compared to 4h, in haploid; no downregulation


2328719Antonia
geneterm extension
map1transcription phenotype, target is not upregulated in response to nitrogen starvationallele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-PC,(strain is H90))
mat1-Pcpositive autoregulation of transcription in response to nitrogen starvationallele=mat1-Pc-161()
map1transcription phenotype, target is not expressed in response to nitrogen starvationallele=deletion,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm,(strain is H90))
mat1-Pctranscription phenotype, target is not expressed in response to nitrogen starvationallele=mat1-Pc-161(),annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm,(strain is H90))
mat1-Pclow constitutive expression in rich mediaallele=H90(fus1 deletion)
mat1-Pmno constitutive expression in rich mediaallele=H90(fus1 deletion)
mat1-Pmexpression in response to nitrogen starvation is dependent on the presence of CL:0002674annotation_extension=occurs_in(CL:0002675)
mat1-Pcupregulation in response to nitrogen starvation is not dependent on the presence of CL:0002674annotation_extension=occurs_in(CL:0002675)
ran1process: negative regulation of transcription from RNA polymerase II promoter during mitosis (IMP evidence code)allele=pat1-114,annotation_extension=has_regulation_target(GeneDB_Spombe:mat1-Pm, mat1-Mc and Mat1-Pc


10438147Antonia
genetermextension
gaf1experiments were performed in Sc. cerevisiae, but investigating pombe proteins
gaf1number of tas etc annotations for gene that can probably be removed once update is done
gaf1RNA polymerase II core promoter proximal region sequence-specific DNA bindinghas substrate GATA boxes (requested term from SO SO:0001840)
gaf1phenotype: has DNA binding activityallele=Gaf1N(AA1-120)
gaf1phenotype: abolished DNA binding activityallele=GAF1C(121-290)


17452352Antonia
genetermextension
ams2expression oscillates during cell cycle, peaks at S-phase (except hht2 which remain constant)
ams2delayed septationallele=deletion
ams2DNA replication appears normalallele=deletion
ams2RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcriptionadd extension: annotation_extension=acts_at(SO: GATA transcr factor - term is requested)
ams2 + hht2synthetic lethality, double mutantallele=deletion
sequence feature annotate AACCCT as a GATA transcription factor binding site, seq 5'-ATCA(C/A)AACCCTAACCCT-3'artemis?
ams2CC nuclear chromosomeacts at(SO:GATA transcr factor binding site


18077559|Antonia
genetermexpression
ams2 hip1slow cell growthallele=dbl mutant


20230746Antonia
genetermextension
ams2 remove NAS and TAS from artemis
ams2protein is unstable during G2 and M phase, partially stable during G1 and stable during S
ams2protein stability: is stable during S phase, level increased
ams2protein stability: is unstable during G2 phase, level decreased OR possibly only synthesised during S phase?
ams2protein stability: is unstable during G1/M phase, level increased OR possibly only synthesised during S phase?
ams2protein stability: is degraded by the SCF ubiquitin ligase pathway
ams2allele=overexpression(overexpression and allele=deletion(deletion)...correct way of writing this is?


18158900Antonia
sim3phenotype: abnormal chromatin silencing at centromere|abnormal at kinetochore(central core/cnt)allele=143(G81E),allele=205(E207K)
sim3phenotype: inviable at 18 degrees, inhibited growth at 25/32/36 degreesallele=deletion
double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed cnp1 = normal phenotype
double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H4 = normal phenotype
double mutantsim3 mutants (allele=143(G81E),allele=205(E207K)) + overexpressed H3 = reduced viability (inviable ok)
sim3go biological process: protein localization to kinetochoreannotation_extension=does not happens_during G1


cnb1,ppb1dbl deletion mutant same phenotype as each single mutant (branched,elongated multi-septate cells + slow growth in presence of mgcl2worth annotating? i.e. shows may be linked perhaps? dbl mutant not more severe
cnb1,ppb1,pmp1dbl del + overexpressed = normal cell growth
cnb1,ppb1deletion,overexpr. slow growth in presence of mgcl2i.e. large amounts of catalytic domain is not functional without regulatory subunit. is this interesting to capture?
cnb1,ppb1∆C(L445->STOPdeletion,overexpressed. slow growth in presence of mgcl2constitutively active mutant is not active without regulatory subunit
cnb1,ppb1∆C(L445->STOPoverexpressed,overexpressed. phenotype growth arrest, round small bent pear-shaped cells. depolarized distr of cortical F-actin patchesnormal phenotype in presence of CHEBI:61049
cnb1,ppb1∆C(L445->STOP,prz1overexpressed,overexpressed, deleted. no growth arrest


16928959Antonia
∆yam8not involved in calcium response in presence of cacl2 or chlorpromazineIMP - phenotype decreased cellular signalling?
∆cch1not involved in calcium response in presence of cacl2 or chlorpromazineIMP


20018864Antonia
genetermextension
ncs1expression:upregulated in response to CHEBI:29108 NOT upregulated in response to CHEBI:6636, CHEBI:26710, CHEBI:32588, CHEBI:30911, CHEBI:32035, or CHEBI:61049IDA
deletion(prz1), overexpression(ncs1)slow growthcell growth assay
deletion(ncs1), overexpression(prz1)slow growthcell growth assay
deletion(prz1), overexpression(ncs1)inviable in_response_to(CHEBI:29108)IMP
deletion(ncs1), overexpression(prz1)inviable in_response_to(CHEBI:29108)IMP
deletion(ncs1),deletion(yam8)normal cell growth in_presence_of(CHEBI:33120cell growth assay
ncs1promoter region lies in -1-130 region caact esp important
ncs1promoter for upregulation in response to calcium lies in -101-130 region
ncs1promoter for basal expression lies in -1-130 region
prz1binds caact in promoter region of ncs1


14722091Antonia
genetermextension
ncs1upregulated in response to CaCl2+


18362178Antonia
genetermextension
acr1phenotype:ringlike nuclear chromatinallele=acr1-936, requested term
nuc1phenotype:ringlike nuclear chromatinallele=nuc1-632, requested term
cut14phenotype=abnormal nucleolar rDNA separationallele=cut14-208,qualifier=at_high_temperature


21879336Antonia
rst2in a ∆pka1 mutant and sam5 and sam7 rst2 is phosphorylated under normal conditions (not in wt)
pka1normal protein localization
pka1normal protein localizationannotation_extension=exists_during:GO:0042149)


19606215Antonia
cnx1dbl mutant phenotype: abnormal cell wall morphologyallele=lumenal_cnx1p(aa_del488-560),allele=C-termTM_Cnx1p_cmyc(aa_del1-415)
cnx1some confusing data regarding apoptosis. Notes in hardcopy paperallele=lumenal_cnx1p(aa_del488-560)
cnx1allele specifications may not be 100% correct


18621924Antonia
cyr1,cgs1 dbl deletionnuclear export abolishedallele=deletion,annotation_extension=localizes(GeneDBSpombe:SPBC106.10)
cgschange annotation concerning localized to nucleus during GO:0009651 to nucleus excluding nucleoluswaiting to see if GO will give a term for this cellular component


12557273Antonia
pik3-/pik3-spore germination abolished, abnormal spore morphologyif a more specified term is added to CL then change CL:0000415 to homozygous diploid, if not then add allele=homozygous?
pik3-/pik3+FYPO:0000579 normal spore germinationadd this with either CL:0000415 + allele=heterozygous or more specific CL if given
pik3have requested 2 process terms from GO (+ve regulation of protein targeting to prospore/vacuolar membraneupdate if granted
pik3abnormal protein targeting to prospore membrane phenotypeallele=deletion,annotation_extension=localizes(PF:01363)


9191269Antonia
plc1qualifier in genedb for binding:"N-term", not clear if it binds N-term or if it binds via N-term"


9191271Antonia
matPimRNA levels increase in response to M-factoroccurs_in(CL:0002675


9388669Antonia
krp1abolished enzymatic activityallele=R82A, qualifier=in_vitro


10792724Antonia
sxa2Normal carboxypeptidase activityK309A
sxa2Normal carboxypeptidase activityK309A,R310K
sxa2No carboxypeptidase activityK309A,R310A
sxa2No carboxypeptidase activityS460*(delS460-Y507)
sxa2No carboxypeptidase activity563(W247->amber
sxa1remove the artemis annotation to BP conjugation with cellular fusion


map3/mam2diploid strain (CL:0000415) cannot sporulate if both receptors expressed at the same time


1563351Antonia
MatPi?expressed in response to nitrogen starvation and M factor in PcellsIDA
ste6MatPi? not expressed during N starvation and in presence of M factor in P cellsallele=deletion
ras1MatPi? not expressed during N starvation and in presence of M factor in P cellsallele=deletion
ras1MatPi? expressed during N starvation and in presence of M factor in P cells, not constitutively expressedallele=ras1val17
pat1/ras1mat1-Pm transcribedallele=pat1-114/deletion, at high temp
pat1/ste6mat1-Pm transcribedallele=pat1-114/deletion, at high temp
8196631Antonia
mfm1/mfm2FYPO:0000584 decreased sporulationallele=deletion (both)
mfm1/mfm3FYPO:0000584 decreased sporulationallele=deletion (both)
mfm2/mfm3FYPO:0000584 decreased sporulationallele=deletion (both)
mfm1/mfm2/mfm3FYPO:0000583 sporulation abolishedallele=deletion (all 3)
mfm1/mfm2/mfm3FYPO:0000583 sporulation abolishedallele=deletion (all 3),annotation_extension=in_presence_of(M-factor - externally added),annotation_extension=occurs_in:CL0002674
mfm1/mfm2/mfm3FYPO:0000590 normal sporulationallele=deletion (all 3),annotation_extension=occurs_in:CL0002674
mfm1expressed in CL:0002674happens during(GO:0006995) - cellular response to nitrogen starvation
mfm2expressed in CL:0002674happens_during(GO:0000278) - mitotic cell cycle
mfm2expression increased in CL:0002674happens during(GO:0006995) - cellular response to nitrogen starvation
mfm3expressed in CL:0002674happens during(GO:0006995) - cellular response to nitrogen starvation
mfm1not expressed in CL:0002675
mfm2not expressed in CL:0002675
mfm3not expressed in CL:0002675
mfm1expression increasedannotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation
mfm2expression increasedannotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation
mfm3expression increasedannotation_extension=occurs_in:CL:0002674,annotation_extension=in_presence_of(GeneDBSpombe:SPCC1795.06 - map2),happens during(GO:0006995) - cellular response to nitrogen starvation


154790Antonia
mfm1/2/3Add on gene page that the final peptide gene product is 9 amino acids long and consists of YTPKVPYM


7975894Antonia
gpa1phenotype: increased expression of MatPi? during nitrogen starvation; constitutively active. Pheromone doesn't influence transcriptionQ244L
ras1phenotype: increased expression of Matpi during nitrogen starvation in the presence of pheromoneG17V
mat1Pm/pipromoter element mapped in paper -61- -41 (ccctctttctttgttccttat


7813430Antonia
krp1expressed in mitotically growing cells
krp1expressed in response to nitrogen starvation
krp1dibasic endopeptidase activity - have one for serine peptidase activity, use that one?need to request term


8314086Antonia
sxa2expressed in presence of p-factor
map2expressed in H- cells
cyr1/sxa2phenotype G1 arrest in presence of P-factor in rich mediaallele=deletion
cyr1/sxa2abnormal/increased shmoo formation in presence of P-factor in rich mediaallele=deletion


18059475Antonia
fkh2reduced zygote formationallele=deletion
fhl1reduced zygote formationallele=deletion
mei4reduced zygote formationallele=deletion
fkh2/fhl1reduced zygote formationallele=deletion
fkh2/mei4reduced zygote formationallele=deletion
fkh2/fhl1/mei4reduced zygote formationallele=deletion
ste11annotate promoter proximal element FLEX1 and FLEXL1 to ste11, artemis
fkh2reduced zygote formationallele=T314E
fkh2reduced zygote formationallele=S462E
fkh2normal zygote formationallele=S481E
fkh2reduced zygote formationallele=T314E,S462E,S481E
fkh2normal zygote formationallele=T314A,S462A,S481A
fkh2normal cell morphologyallele=T314E
fkh2normal cell morphologyallele=S462E
cig2increased rate of zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2increased zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/fhl1reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/mei4reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)
cig2/fkh2/fhl1/mei4reduced zygote formationallele=deletion,happens_during(GO:0006995 - cellular response to nitrogen starvation)


7651414Antonia
mat1have annotated M specific genes to the genes closest to the centromere (around 2120000). eg mat3m, matmc_2 NOT mat1-m or matmc_1. I think this is correct but dbl-check once artemis files are updated on genedb
mat1-mm)expressed in response to P-factor and nitrogen starvationIDA
mat1-pmexpressed in response to nitrogen starvationIDA


10867006Antonia
ste11Unable to bind DNA region outside of the consensus motifste91


9418887Antonia
krp1abolished serine endopeptidase activityallele=S371A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=K81I,R82A,R102K,S371A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=R82A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=K81I,R82A ODA, qualifier=in_vitro
krp1normal serine endopeptidase activityallele=R102K ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=R82A,R102K ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=I81I,R82AR102K ODA, qualifier=in_vitro
krp1reduced serine endopeptidase activityallele=R102A ODA, qualifier=in_vitro
krp1reduced serine endopeptidase activityallele=R82A,R102A ODA, qualifier=in_vitro
krp1reduced serine endopeptidase activityallele=K81I,R82A,R102A ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=aa_del579-709 ODA, qualifier=in_vitro
krp1abolished serine endopeptidase activityallele=aa_del591-709 ODA, qualifier=in_vitro
krp1normal serine endopeptidase activityallele=aa_del612-709 ODA, qualifier=in_vitro


10931354Antonia
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=S271A ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R102K ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R82A ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=R82A,R102K ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R82A,R102K,qualifier=overexpression ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=R102A ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R102A,qualifier=overexpression ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=R82A,R102A ODA
krp1normal enzymatic activity (normal serine endopeptidase activity)allele=R82A,R102A,qualifier=overexpression ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=aa_del579-709 ODA
krp1no enzymatic activity (abolished serine endopeptidase activity)allele=aa_del591-709 ODA


15580593Antonia
mam2negative regulation of pheromone INDEPENDENT signal transduction. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)
Mam2 mutantsphenotype: constitutively active (if term goes inM cells


15659165Antonia
mam2negative regulation of pheromone INDEPENDENT signal transduction. Sequesters G alpha. If I can't get this term from GO then use negative regulation of signal transduction involved in conjugation with cellular fusion + add the extension "in absence of P-factor" (occurs in M-cells)
Mam2P261Lphenotype: constitutively active (if term goes inM cells
mam2cellular component, homodimeric complex; will come under GO:0043235IDA
mam2/gpa1interaction evidence is wrong, but it's the best fit....should I not curate this? I think the evidence is pretty strong


19285552Antonia
rgs1phenotype: increased sensitivity to pheromoneallele=deletion, in M cells


21118960
srw1another phenotype: decreased cell cycle arrest in response to pheromoneallele=mutPste9(A->C and G-> T and vice versa throughout 27 bp reb1 binding region -198 - -172
srw1decreased sporulationmutPste9
srw1 ectopically expressed | reb1 deletionnormal cell cycle arrest in response to pheromonephenotype
reb1|wee1phenotype: slow growth at high temperatureallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: multiseptate (0000118)allele=deletion(reb1)/wee1-50
reb1|wee1phenotype: weeallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: spheroid cellsallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: DNA content increasedallele=deletion(reb1)/wee1-50
reb1|wee1phenotype: normal cell growth at high temperaturein_presence_of:CHEBI:44423, allele=deletion(reb1)/wee1-50
reb1|cdc10phenotype: slow growth at high temperatureallele=deletion(reb1)/cdc10-129
reb1|cdc10phenotype: abnormal? cell cycle arrestqualifier=at_high_temperature,allele=deletion(reb1)/cdc10-129
reb1 change cell cycle arrest in mitotic G1 phase to "increased rate of"allele=overexpression


17875641updates DONE as of 2011-08-22


21775631
gene term extension
mug79expression is meiosis specific
mug79requested GO term for meiosis specific spindle pole body GO:0035974


21813639Midori
mcb1GO:0005737extension: throughout cell cycle (see nuclear pore/PMID:20970342 above)
mcb1GO:0005654extension: throughout cell cycle
mcb1GO:0000790extension: throughout cell cycle
mcb1-chk1 genetic interactionalleles OP-mcb1+chk1-deletion, mcb1-D2+chk1-deletion; mcb1-D22+chk1-deletionOP-mcb1+chk1-del phenotype small cells (FYPO:23), abnormal nuc morph (FYPO:62)
mcb1-rad3 genetic interactionalleles OP-mcb1+rad3-deletion, mcb1-D2+rad3-deletion; mcb1-D22+rad3-deletionOP-mcb1+rad3-del phenotype small cells (FYPO:23), abnormal nuc morph (FYPO:62)


20929775Midori
swi6deletionadd phenotype abolished prot loc to cen (annotation_extension=localizes(Hrk1)
swi6deletionadd phenotype abolished prot loc to cen (extension: Pds5)
pds5deletionadd phenotype abolished prot loc to cen (extension: Hrk1)
hht1,hht2,hht3all 3 T3A (triple mutant)phenotype decreased prot loc to cen (extension: Ark1); lagging chromosomes (qualifier=low expressivity)
hta1,hta2both S121A (triple mutant)phenotype decreased prot loc to cen (extension: Ark1); lagging chromosomes (qualifier=low expressivity)
hht1,hht2,hht3,sgo2delall 3 hht T3A + sgo2del (quadruple mutant)phenotypes abolished loc to cen (ext Ark1); lagging chromosomes (qualifier=high expressivity)
hht1,hht2,hht3, hta1,hta2all 3 H3 T3A, both H2 S121A (quintuple mutant)phenotypes abolished loc to cen (ext Ark1); lagging chromosomes (qualifier=high expressivity)
hht1,hht2,hht3all 3 T3A (triple mutant)genetic interaction synthetic lethal sgo2deletion
hht1,hht2,hht3, hta1,hta2all 3 H3 T3A, both H2 S121A (quintuple mutant)genetic interaction synthetic lethal
hht1,hht2,hht3, hta1,hta2all 3 H3 T3A, both H2 S121A (quintuple mutant) genetic interaction synthetic lethal
genetic interactionhrk1, swi6"asynthetic"; check for old same-pathway GO IGI
hht1,hht2,hht3all 3 T3A (triple mutant)genetic interaction "asynthetic" with hrk1deletion
Hrk1-Bir1physical interactionBIR domain of Bir1 (Pfam:PF00653)
hrk1 bub1 genetic interactionalleles hrk1 deletion; bub1-KD (kinase dead, K762R,D900N)phenotype slow growth
hrk1 sgo2 genetic interactionalleles both deletionphenotype slow growth
pds5 bub1 genetic interactionalleles pds5 deletion; bub1-KD (kinase dead, K762R,D900N)phenotype slow growth
pds5 sgo2 genetic interactionalleles both deletionphenotype slow growth
swi6 sgo2 genetic interactionalleles both deletionphenotype slow growth